Amicus Curiae Brief — Bragdon v. Abbott

Sl

Supreme Court, U. S,

(A "its fs

APR 23 1999

No. 98-1536

CLERK

In The this

Supreme Court of the United States

October Term, 1998

+

RANDON BRAGDON, D.M.D.,

Petitioner,

SIDNEY ABBOTT, et al.,

Respondents.

*

On Petition For A Writ Of Certiorari

To The United States Court Of Appeals

For The First Circuit

+

BRIEF OF THE AMICUS CURIAE CLINICAL

RESEARCH ASSOCIATES IN SUPPORT OF

RANDON BRAGDON, D.M.D., PETITIONER

¢

RicHarp L. Hit, Esa.

Counsel of Record for Amicus Curiae,

Clinical Research Associates

Hitt, JOHNSON & ScHumMTz, P.C.

Jamestown Square

3319 North University Avenue

Suite 200

Provo, Utah 84604

(801) 375-6600

COCKLE LAW BRIEF PRINTING CO., (800) 225-6964

OR CALL COLLECT (402) 342-2831

i

TABLE OF CONTENTS

STATEMENT OF INTEREST OF AMICUS CURIAE.. 1

SUMMARY OF ARGUMENT....................... y

ih oc Re CERIN Sra 3

THE UNIVERSAL PRECAUTIONS CONCEPT

DOES NOT ALLEVIATE SIGNIFICANT RISK TO

CAREGIVERS DURING TREATMENT OF INFEC-

TIOUS PATIENTS BECAUSE THE PRODUCTS

NECESSARY TO IMPLEMENT THE CONCEPT

OFTEN FAIL THEIR INTENDED PURPOSE...... 3

PO MOR Rey Co ce Oey ee 7

Latex Examination Glove SONY 5 Po 9

Environmental Surface Disinfectants ........... 11

Instrument Immersion Disinfectants............ 14

Sterilization Equipment......................__ 15

SWE PeR MMNn chia k tevuiati occas wick 17

APPENDIX INDEX

Knox, Richard A., A Nurse Hopes Her Infection Will

Spur Action, Boston Globe, (April 6, 1999) (Ref-

ap edie: at ERE PONS ET OH ERE tna rt ied App. 1

United States General Accounting Office, Report to

Congressional Requesters, GAO/RCED-90-139,

DISINFECTANTS: EPA Lacks Assurance They Work

(August 1990) (Reference RW ahs hays App. 5

il

TABLE OF CONTENTS - Continued

Page

Altman, Lawrence K, M.D., New York Times,

Investigating a Medical Maze: Virus Transmission

in Surgery — Hepatitis B was Apparently Spread by

a Doctor, but How?, New York Times (March 22,

1994): (Reference. No. 3)... Save cc evaaeewcen) App. 14

Harpaz, Seidlein, Averhoff, Tormey, Sinha, Kot-

sopoulou, Lambert, Robertson, Cherry and

Shapiro, Transmission of Hepatitis B Virus to Mul-

tiple Patients from a Surgeon Without Evidence of

Inadequate Infection Control, The New England

Journal of Medicine, Volume 334, Number 9

(February 29, 1996) (Reference No. 4)........ App. 21

Christensen, Robison, Robinson, Ploeger, and

Leavitt, Efficiency of 42 Brands of FaceMasks and 2

Face Shields in Preventing Inhalation of Airborne

Debris, General Dentistry (November-December

1991) (Reference .No. She. jase hckeeecteeenn’ App. 41

Clinical Research Associates, SUBJECT: Operating

Gloves, Important New Trends, CRA Newsletter

Volume 19, Issue 9 (September 1995) (Reference

IG, Oi ccs acawdhcee ce ek eee ee App. 57

Clinical Research Associates, SUBJECT: Gloves,

Non-Sterile Operating, Update Review, CRA

Newsletter, Volume 16, Issue 10 (October 1992)

(Raetewenee ING. 2)... esses ck cecw van cane mer ues App. 61

Clinical Research Associates, SUBJECT: Gloves,

Non-Sterile Latex, CRA Newsletter Volume 15,

Issue 9 (September 1991) (Reference No. 8) App. 67

Clinical Research Associates, SUBJECT: Operating

Gloves, Update, CRA Newsletter Volume 13,

Issue 1 (January 1989) (Reference No. 9)....App. 73

we ny cen

AI Dt NR ol aN st hl A Ay lh Sa DSS ME ee

Cae ee RICH ert OS Mave nl Sh

aE Saal Be wet tt ma! ee

iii

TABLE OF CONTENTS - Continued

Page

Korniewicz, Laughon, Cyr, Lytle, and Larson,

Leakage of Virus through Used Vinyl and Latex

Examination Gloves, Journal of Clinical Micro-

biology, pp. 787-788 (April 1990) (Reference No.

ERY ee Sh aoe ae Sahay a ae a a App. 78

Mbithi, Springthorpe, Boulet, and Sattar, Survival

of Hepatitis A Virus on Human Hands and Its

Transfer on Contact with Animate and Inanimate

Surfaces, Journal of Clinical Microbiology, pp.

757-763, (April 1992) (Reference No. 11) ....App. 85

Gwaltney and Hendley, Transmission of Experimen-

tal Rhinovirus Infection by Contaminated Services,

American Journal of Epidemiology (1982) (Ref-

WOE POO MME Wiss 660s GeV 50h bid oiek Lk, App. 109

Letter to the Editor, Inactivation of Human Immu-

nodeficiency Virus-1 at Short Time Intervals Using

Undiluted Bleach, Journal of Acquired Immune

Deficiency Syndromes, Volume 6, Number rs

bane wperenenee NO. 19) 0 occcesecccccscs.. App. 119

Christensen, Robison, Robinson, Ploeger, Leavitt

and Bodily, Antimicrobial Activity of Environmen-

tal Surface Disinfectants in the Absence and Pres-

ence of Bioburden, Journal of American Dental

Association, Volume 119 (October 1989) (Refer-

RNS aise i giicues ceric cs cece, App. 125

Clinical Research Associates, SUMMARY CHART:

Environmental Surface Disinfectants, (1999)

(compiling results of CRA Newsletter, Volume

18, Issue 3 (November 1994); Volume 19, Issue 1

(January 1995); Volume 20, Issue 11 (November

1996), and Volume 23, Issue 4 (April 1999)) (Ref-

MI RIN 6556 isco k's ah Fs ois ord co ccc, App. 159

iv

TABLE OF CONTENTS - Continued

Page

Robison, Robinson, Ploeger and Christensen,

Tuberculocidal Activity of Glutaraldehyde and Glu-

taraldehyde/Phenol Disinfectants, Journal of Den-

tal Research, Volume 69, p. 379, Abstract No.

2161 (March 1990) (Reference No. 16)....... App. 161

Clinical Research Associates, SUBJECT: Disinfec-

tants, Instrument Immersion, CRA Newsletter

Volume 15, Issue 5 (May 1991) (Reference No.

Fk PT oe ie Re ES say Sona ae? App. 163

Kolstad, Robert A., Ph.D., How Well Does the Chem-

iclave Sterilize Handpieces? Journal of American

Dental Association, Volume 129 (July 1998)

(CRelecsmen INO. 2B). ise Scenes Cee eR Sees ee eee App. 171

V

TABLE OF AUTHORITIES

STATUTES:

Ae URS ER eae ck co eae 10

OTHER AUTHORITIES:

Altman, Lawrence K, M.D., New York Times,

Investigating a Medical Maze: Virus Transmission

in Surgery — Hepatitis B was Apparently Spread by

a Doctor, but How?, New York Times (March 22,

1994) (Reference No. 3)........... Pert 5 PReOe cep eee 5

Christensen, Robison, Robinson, Ploeger, Leavitt

and Bodily, Antimicrobial Activity of Environmen-

tal Surface Disinfectants in the Absence and Pres-

ence of Bioburden, Journal of American Dental

Association, Volume 119 (October 1989) (Refer-

saties ntti ih cioc oO OE PE PORE AR fy SRLS Res ii, i3

Christensen, Robison, Robinson, Ploeger, and

Leavitt, Efficiency of 42 Brands of FaceMasks and 2

Face Shields in Preventing Inhalation of Airborne

Debris, General Dentistry (November-December

soya) (rementence- Ne S) ris ee 7

Clinical Research Associates, SUBJECT: Disinfec-

tants, Instrument Immersion, CRA Newsletter

Volume 15, Issue 5 (May 1991) (Reference No.

AF) F0LEs CEERRG TEU OTE TORT TE ee 14

Clinical Research Associates, SUBJECT: Gloves,

Non-Sterile Latex, CRA Newsletter Volume 15,

Issue 9 (September 1991) (Reference No. 8) ........ 9

Clinical Research Associates, SUBJECT: Gloves,

Non-Sterile Operating, Update Review, CRA

Newsletter, Volume 16, Issue 10 (October 1992)

etic inns a He ds. eS ETE EPP OE a bee aa )

vi

TABLE OF AUTHORITIES — Continued

Page

Clinical Research Associates, SUBJECT: Operating

Gloves, Important New Trends, CRA Newsletter

Volume 19, Issue 9 (September 1995) (Reference

oo eae) MRR RE Uy age es CU pete, gre Syed Oem soo ae 9

Clinical Research Associates, SUBJECT: Operating

Gloves, Update, CRA Newsletter Volume 13,

Issue 1 (January 1989) (Reference No. 9)..........- Yy

Clinical Research Associates, SUMMARY CHART:

Environmental Surface Disinfectants, (1999)

(compiling results of CRA Newsletter, Volume

18, Issue 3 (November 1994); Volume 19, Issue 1

(January 1995); Volume 20, Issue 11 (November

1996), and Volume 23, Issue 4 (April 1999)) (Ref-

CERNE INNO. RO he 4's ads dbkedawated avedewowes bas 11, 13

Gwaltney and Hendley, Transmission of Experimen-

tal Rhinovirus Infection by Contaminated Services,

American Journal of Epidemiology (1982) (Ref-

ORONOD TH BEN bs ooo oc ove weve ee ueewkerinsees 11, 12

Harpaz, Seidlein, Averhoff, Tormey, Sinha, Kot-

sopoulou, Lambert, Robertson, Cherry and

Shapiro, Transmission of Hepatitis B Virus to Mul-

tiple Patients from a Surgeon Without Evidence of

Inadequate Infection Control, The New England

Journal of Medicine, Volume 334, Number 9

(February 29, 1996) (Reference No. 4).............. 5

Knox, Richard A., A Nurse Hopes Her Infection Will

Spur Action, Boston Globe, (April 6, 1999) (Ref-

OTERO EO: TG i 6 oink one Kiss hah eee eae va 3, 10

Kolstad, Robert A., Ph.D., How Well Does the Chem-

iclave Sterilize Handpieces? Journal of American

Dental Association, Volume 129 (july 1998)

CReGIRII TWO: Ba ons sobs bs on bck seeeneae 15, 16

Re Me eT Re a

Vii

TABLE OF AUTHORITIES —- Continued

Page

Korniewicz, Laughon, Cyr, Lytle, and Larson,

Leakage of Virus through Used Vinyl and Latex

Examination Gloves, Journal of Clinical Micro-

biology, pp. 787-788 (April 1990) (Reference No.

PEP < sib bee AbaRS ON CKES CORT EE KERN TS OS Be 9, 10

Letter to the Editor, Inactivation of Human Immu-

nodeficiency Virus-1 at Short Time Intervals Using

Undiluted Bleach, Journal of Acquired Immune

Deficiency Syndromes, Volume 6, Number 2,

For UN RN ee a5; de

Mbithi, Springthorpe, Boulet, and Sattar, Survival

of Hepatitis A Virus on Human Hands and Its

Transfer on Contact with Animate and Inanimate

Surfaces, Journal of Clinical Microbiology, pp.

757-763 (April 1992) (Reference No. hk Ree ae 1i, 12

Robison, Robinson, Ploeger and Christensen,

Tuberculocidal Activity of Glutaraldehyde and Glu-

taraldehyde/Phenol Disinfectants, Journal of Den-

tal Research, Volume 69, p- 379, Abstract No.

2161 (March 1990) (Reference No. _ _ SOOM ae 14

United States General Accounting Office, Report to

Congressional Requesters, GAO/ RCED-90-139,

DISINFECTANTS: EPA Lacks Assurance They Work

(August 1990) (Reference No. <2 FERRER cee ee 4

STATEMENT OF INTEREST OF AMICUS CURIAE

Clinical Research Associates hereby submits this

brief as amicus curiae in support of Dr. Randon Bragdon,

D.M.D.! The brief is submitted by the written consent of

all parties to the suit.

Clinical Research Associates, known worldwide as

CRA, was initiated over 23 years ago by dental clinicians

to test the efficacy and clinical usefulness of products

they use in dental treatments. CRA is a unique non-profit

research organization comprised of 45 on-site basic scien-

tists, engineers, and support staff, plus over 400 dental

clinicians located in 18 countries who volunteer their time

and expertise to field test products within their practice

environments. CRA’s activities have been compared to

Consumers’ Union and the Consumers’ Report publica-

tion, although CRA works only with products used in

dental treatments. CRA performs about 20,000 product

evaluations each year, working with about 650 different

products secured from the worldwide market. Results of

CRA’s work are published monthly in nine languages and

circulated to 72 countries.

Since its inception, CRA has worked actively with

infection control products, including over 60 different

face-mask brands, 36,000 gloves, 20 different types and

Styles of protective clothing, over 150 different environ-

mental surface disinfectant formulations, 25 instrument

immersion disinfectants, 15 commercial heat sterilizers,

' Pursuant to Supreme Court Rule 37.6, this brief was

prepared entirely by counsel for CRA. No monetary

compensation was received from any other person or entity.

12 different designs of air purification equipment, and

over 40 different products sold for treatment of dental

unit waterlines. CRA is the only place in the world where

all types of infection control products used in dentistry

receive extensive efficacy testing routinely.

CRA’s mission and only purpose is to test products

used in dental treatments for efficacy and clinical useful-

ness, and to communicate to the dental community all

results.

SUMMARY OF ARGUMENT

Throughout the proceedings of this case in the lower

courts, the following key issue has failed to receive con-

sideration: Efficacy of the “universal precautions” con-

cept, claimed by experts to protect clinicians and patients

against significant risk of transmission of infectious dis-

eases, is flawed seriously by the fact that it is totally

dependent on the efficacy of products used to implement

it (face-masks, operating gloves, disinfectants, sterilizers,

etc.). CRA’s lab has tested thousands of products used for

infection control to support the universal precautions

concept over the past 23 years, and has demonstrated

clearly and repeatedly that most of these products avail-

able worldwide fail to meet their intended purposes.

Failure of infection control products that support the universal

precautions concept virtually negates the concept. Although

there may be a visual appearance of protection, if masks

fail to filter properly, operating gloves leak, and disinfec-

tants and sterilizers fail to kill as expected, this places

both clinicians and patients at significant risk every time

infectious organisms are present. Furthermore, efficacy of

all the products, efficacious or not, needed to protect

clinicians and patients from infectious disease transmis-

sion is easily compromised by clinical mistakes and acci-

dents, which can occur unexpectedly at any time and

inflict a lifetime of serious ill health and/or untimely

death. (See reference # 1, pages App. 1-4).?

¢

ARGUMENT

THE UNIVERSAL PRECAUTIONS CONCEPT DOES

NOT ALLEVIATE SIGNIFICANT RISK TO CARE-

GIVERS DURING TREATMENT OF INFECTIOUS

PATIENTS BECAUSE THE PRODUCTS NECESSARY

TO IMPLEMENT THE CONCEPT OFTEN FAIL THEIR

INTENDED PURPOSE

Because microbes are invisible, clinicians cannot

determine by themselves the efficacy of the infection

control products they use. They have no way to test for

face-mask filtration capacity, operating glove leakage,

and disinfectant and sterilizer kill. Ideally, efficacy of

these critical products should be confirmed before each

patient treatment, but no tests exist anywhere that pro-

vide this capability. CRA has demonstrated that product

cost cannot be used as an indicator of product efficacy. So

this leaves clinicians totally at the mercy of the product

manufacturer’s integrity. All the above factors open

? All articles referenced herein are reproduced in the

Appendix to this brief, noted by reference number and page

number.

opportunities for extensive deception and fraud in prod-

uct promotional claims.

Today none of the agencies originally entrusted with

safeguarding the public against non-efficacious products

used in healthcare such as the EPA, FDA, CDC and

American Dental Association, actually fest the products

they certify or recommend. Although doubts about disin-

fectant efficacy have been pointed out by the General

Accounting Office (GAO), (See reference # 2, pages App.

5-13), lack of government funding for a central testing lab

allows the problem to continue unabated.

Today, after many years without non-biased confirm-

atory testing there now exists a large number of products

promoted as protective against transmission of infectious

microbes that, in fact, do not fulfill that purpose. Clini-

cians purchase and use these products routinely, hoping

they are protected. The authors of the universal precau-

tions concept and the experts who have testified in this

case that no precautions should be taken by caregivers

beyond those prescribed by the universal precautions

concept have all assumed that the products that support

the concept perform as expected. This means the prod-

ucts are assumed to block microbes or kill microbes

before they enter the clinician’s body.

CRA’s work demonstrates that these assumptions are

ill founded. In actuality, every time a person with an

infectious disease is treated, the clinician plays Russian

roulette with his own health, and his life, as well as his

attending staff and subsequent patients.

This brief is supported by data from studies per-

formed by CRA and others, included in the appendix

Sai Bi nce hee A Act tS 20) ie

4

-

SY

7]

;

%

hereto, which clearly demonstrate that this blind faith in

the protection afforded by infection control products

(universal precautions) is not justified.

Of critical importance in the instant case, the data

demonstrate the protective measures commonly referred

to as universal precautions do not provide the protection

claimed by the authorities and experts referenced in the

testimonies cited in this case. Unfortunately, the experts

whose testimony was presented by Respondents in the

proceedings before the First Circuit on remand? are not

microbiologists actually involved in testing efficacy of

infection control products.

It appears the experts based their testimonies on the

assumption that large numbers of healthcare providers

are not believed to have become HIV positive from work-

related exposures. This does not mean there is not signifi-

cant risk to caregivers using the universal precautions

concept. There are cases on record where experts have

been frustrated and perplexed because serious transmis-

sions occurred in the presence of all the proper universal

precautions. These cases point clearly to the fact that

universal precautions strategies can, and do, fail to pro-

tect both clinicians and patients. (See references # 3 & 4

on pages App. 14-40).

Every breach does not elicit an infection, as the refer-

enced paper illustrates. Although the hepatitis B infected

* This testimony is contained in CDC’s 1987 Recommen-

dations for Prevention of HIV Transmission in Health-Care Settings,

36 MMWR No. 2S (Aug. 21, 1987), as referenced in Dr. Bragdon’s

brief at pages 4-5.

surgeon caused disease in 18 patients, another 124 he

treated did not contract the disease. This is because a

whole set of circumstances generally must coincide at the

moment of organism transfer in order for the infection to

result in subsequent disease. These circumstances are

thought to include, but are not limited to, such factors as:

(1) virulence of the microorganism at the time of transfer,

(2) numbers of the microorganism transferred, and (3) the

immune status of the recipient at the time of transfer.

Hence, in every case, chance plays a part in whether or

not infection will escalate to disease. Indeed, the word

“disease” is defined as “failure of the adaptive mechanisms

of an organism to counteract adequately the stimuli or

stresses to which it is subject, resulting in disturbance in

the function or structure of any part... ” (Blakiston’s

Pocket Medical Dictionary) (4th ed. 1976) (emphasis

added). Therefore, it needs to be understood from the

beginning that determination of “significant risk” is more

than a numbers game of how many infected people con-

stitute “significance.” It is, more importantly, a deter-

mination of the importance of each human life suddenly

affected by chance when a face-mask or glove leaks infec-

tious materials, or a disinfectant or sterilizer fails to kill

critical microbes, or a needle or other sharp instrument

penetrates barriers. In truth, determination of significant

risk pits the life of the infected patient against the life of

the uninfected caregiver, and the court is charged with

the responsibility to choose which is to be favored.

CRA submits the following data as evidence that the

products used to implement the universal precautions

concept cannot be relied upon to alleviate the significant

risk always present when clinicians treat patients with

infectious diseases:

1. Face-Mask Efficacy (See reference # 5 on pages

App. 41-56).

When 42 different face-masks and 2 face shields used

by dental clinicians in the U.S. were tested for ability to

block aerosolized bacteria, only 22 of the 42, or about half

(52%), passed this test. In further tests with the 42 masks,

when blue dye was aerosolized to simulate microbe laden

aerosols generated during dental procedures, and a

human subject within a sealed chamber breathed the dye

laden aerosols, all the masks (100%) showed significant

leakage through to the mask interior, and only one of the

42 masks was designed in such a way that it could be

adapted at its border to fit securely enough to block dye

penetration at this critical interface. We have since found

that all face-masks sold worldwide to dental clinicians

become overloaded quickly (within 10 to 30 minutes) and

allow material to penetrate to the mask interior, and only

two masks are designed that prevent ingress of materials

at the periphery.

This penetration of debris aerosolized from the

patient's oral cavity is highly significant because it brings

infectious organisms from another person’s body into

direct contact with the lips, nostrils, and skin, and into

the respiratory passages. This affords the possibility for

direct contact of critical mucous membrane tissues with infec-

tious material.

Current mask designs do not provide any way for

clinicians to determine when leak-through begins or the

amount present. Therefore, as masks entrap and fill up

with aerosolized material, and leak to the mask interior,

the mask becomes a source of, rather than a barrier to,

aerosolized infectious microorganisms.

Dental handpieces and their cutting drills used to

perform the tooth drilling emit large amounts of air and

water under pressure while rotating at speeds up to

250,000 to 300,000 rpm. These instruments cause massive

aerosolization of patients’ oral tissues. Research confirms

that about 50% of the aerosols generated during dental

procedures are three tm and smaller in size. Such parti-

cles remain suspended at the end of treatment for long

time periods, creating risk even after treatment of infec-

tious patients is completed. Furthermore, three 1m and

smaller aerosols can penetrate the human respiratory sys-

tem all the way to the alveoli of the lower respiratory

tract, which greatly increases infectivity. Although the

experts in this case claimed that they know of no cases

where HIV has been transmitted by aerosols, in dental

applications the possibility of such a transmission cannot -

be denied. It is known that HIV particles can be present

: in saliva. It is known that saliva is aerosolized during use

of dental handpieces, ultrasonic scalers, air polishers, and

in many other less obvious dental treatments. It is known

that face-masks do not present an impenetrable barrier.

These facts lead to the conclusion that risk is present, and

transmission of HIV to alveolar macrophages and other

key cells within the lungs is possible during dental pro-

cedures.

CRA submits that the referenced data show face-

masks do not provide the protection expected by dental

clinicians from infectious saliva, blood, pus, tooth debris

ie RA PREAH att A Wy sail

PA Me a BEF

SESE eh ea chee ae St Week eat ae Nae oat

and other materials aerosolized during dental treatment,

and they leave clinicians subjected to significant risk of

disease transmission while creating the illusion of protec-

tion.

2. Latex Examination Glove Efficacy - (See refer-

ences # 6-10, pages App. 57-84).

Over its 23 years of operation, CRA has tested over

36,000 clinical operating gloves made of latex, vinyl,

nitrile, and other non-latex materials. If we consider just

the gloves made of latex, since these are the most used,

CRA has tested 84 different brands manufactured in the

U.S., Malaysia, Taiwan, India, China, and Thailand. If we

combine the pinhole data* for latex gloves from just the

test results published in the enclosed references, and do

not include any other reports, we find an overall preva-

lence of 6.75% pinholes in the glove brands tested. (See

references # 6-9, pages App. 57-77.) Most pinholes are not

visible to the naked eye, but can be disclosed by filling

the glove with air and submerging it in water, by filling

the glove with water and looking for seepage of the water

to the external after a few minutes, by viewing the glove

under a scanning electron microscope, or by rubbing

gloved hands of humans with dye and then looking for

dye spots on the hands of the person after degloving.

Most dentists treat about 15 patients per day and

work about 240 days per year. The 6.75% pinholes found

* A pinhole is defined as a small breach in the integrity of

the glove material generally resulting from manufacturing

problems.

10

by CRA allows the average dentist to use about 486 gloves in

a year that have holes in them that permit the patient debris,

which the dentist wears gloves to avoid, to leak through

the gloves and onto their hands. Using the 4% pinhole

maximum allowed by the FDA for latex examination

gloves, a dentist would use 288 gloves in a work year that

leaked.

All of CRA’s glove integrity test data above is the

result of testing new, unused latex examination gloves.

Logically, clinical use stresses latex gloves, and causes

one to suspect an increasing number of breaches in this

barrier as use time and work challenges increase. Tests

performed at Johns Hopkins University School of Nurs-

ing (See reference # 10, pages App. 78-84) showed a

volume increase in fluid leaked by 240 latex gloves tested

of 0.08 ul in new unused gloves vs. 2.20 pl in gloves

subjected to simulated clinical procedures. This repre-

sents more than a 27-fold increase in material leaked due

to usage. So not only must clinicians beware of leakage of

new, unused gloves, but they must expect significantly

more leakage as they move through routine procedures.

And it is self-evident that latex gloves are easily pene-

trated by sharp instruments. It is also evident that it is

not necessary to be exposed to a large quantity of infected

blood to become HIV positive following an accident (See

reference # 1, pages App. 1-4).

What number of glove leaks constitutes a “significant

risk,” within the meaning of 42 U.S.C. § 1282(b)(3)? CRA

submits that the referenced data show latex examination

gloves do not provide the protection expected by dental

clinicians from infectious saliva, blood, pus, tooth debris,

soft tissue, and other materials handled during dental

11

treatment, and they leave clinicians subjected to signifi-

cant risk of disease transmission while creating the illu-

sion of protection.

3. Environmental Surface Disinfectants (See refer-

ences # 11-15, pages App. 85-160).

Environmental surface disinfectants are liquids used

on a vast variety of objects in homes, offices, hospitals,

restaurants, hotel rooms, and dental operatories. They are

used on all types of surfaces ranging from toilet seats and

bowls, kitchen sinks and counters, and walls and floors

everywhere, to objects in dental operatories and hospital

operating rooms.

The wide variety of applications and uses has

inspired the creation of a large number of products,

which unfortunately do not perform equally well. Yet to

most people, any container labeled “disinfectant” is pre-

sumed to kill everything, instantly and completely. This

perception represents a gross misunderstanding of the

chemistry of disinfectants and the physiology of micro-

organisms, and can cause serious mistakes to be made by

those who select the disinfectants to be used in clinical

treatment areas, exposing the clinical personnel to signifi-

cant risk.

Although the potential of contaminated environmen-

tal surfaces to transmit diseases has been questioned,

confirmation of the fact that organisms are not rendered

non-viable immediately upon leaving the body has

always made it impossible to rule out environmental

surfaces as fomites. In addition, experiments designed

12

specifically to investigate this point have repeatedly dem-

onstrated transmission of both infection and disease. For

example, in experiments using human hands contami-

nated with hepatitis A virus, it was shown clearly that the

virus was transferred from hand to hand, from hands to

objects, and from objects to hands (See reference # 11,

pages App. 85-108). In other experiments, healthy human

volunteers were infected with colds by handling tiles and

cup handles contaminated by the investigators with rhi-

novirus (See reference # 12, pages App. 109-118). While

CRA is unaware of similar experiments using HIV, exper-

iments by competent researchers experienced in handling

HIV reported viable virus still present after five minutes

of exposure to a 10% dilution of household bleach. (See

reference # 13, pages App. 119-124).

This indicates that HIV is relatively resistant, at least

to the 1:10 bleach, which has been recommended as the

environmental surface disinfectant of choice by the CDC

for many years.

Since clinicians perceive all disinfectants as equally

effective, they shop for formulations that are cosmetically

pleasing (agreeable fragrance, does not corrode or stain,

visually pleasing packaging, etc.), and never stop to con-

sider microbial kill. This is done under the misplaced

assumption that consumers are protected from ineffective

disinfectants by EPA and FDA regulations. Although

these agencies have the authority to control which disin-

fectants are sold within the U.S., neither performs con-

firmatory tests for efficacy and both lack a simple and

clear communication system to inform consumers about

what the disinfectant can and cannot do. These problems

have resulted in use of disinfectants that do not kill

che donate

7

j

3

4

3

13

properly and leave viable organisms intact and able to

infect people in most of the medical and dental facilities

throughout the U.S.

Of 39 environmental surface disinfectants commonly

used by dental clinicians and tested by CRA in 1988-89,

only three, or 8% passed all the tests. (See reference # 14,

pages App. 125-158). This means 92% of 39 products

could not kill a clinically representative, resistant virus

(poliovirus) and bacteria (the tuberculosis bacteria,

Mycobacterium bovis) in both the absence and presence of

human blood.

Five years later after packaging, ownership, and for-

mulation changes by many disinfectant manufacturers,

CRA revisited this work and added some new formula-

tions. So far, 59 formulations have been tested in this

second round and only seven have passed all the tests,

(See reference # 15, pages App. 159-160), which means

88% still fail to kill under clinically relevant conditions.

Of the six disinfectant active ingredients used world-

wide, only two provide broad spectrum disinfection, and

even these must be used at specific dilutions and/or in

specific combinations with certain other chemicals, or

they also fail to kill. Ethyl alcohol at about 70% by weight

and household or institutional bleach diluted no more

than 1:2 were the only formulations that provided reliable

kill, regardless of the test method, test organism, or con-

tact time used, both in the absence and presence of fresh

human whole blood.

CRA submits that the referenced data show that most

environmental surface disinfectants do not provide the

microorganism kill expected by dental clinicians, and

14

they leave clinicians subjected to significant risk of dis-

ease transmission while creating the illusion of protec-

tion.

4. Instrument Immersion Disinfectants (See refer-

ences # 16-17, pages App. 161-170).

Formulations of instrument immersion disinfectants

can differ from environmental surface disinfectants, so

they are considered separately here. Glutaraldehyde (ide-

ally at dilutions of about 2% or 3%) has been the world-

wide standard for instrument immersion for the past ten-

plus years. It should not be used for environmental sur-

faces because it emits fumes that can be toxic when it is

used liberally on countertops in unventilated areas, it can

elicit skin sensitivities, and it generally has a slow kill of

the tuberculosis bacteria that would extend surface con-

tact times beyond all practicality. However, as an instru-

ment immersion disinfectant its characteristics of reliable

broad spectrum kill, even in the presence of gross

amounts of bodily contaminants such as blood, feces,

tissue, etc., make it a very unique and valuable clinical

product.

However, even glutaraldehyde disinfectants are not

foolproof. In 1991, when CRA tested 12 different formula-

tions (sold under 12 different brand names), water dilu-

tions of the disinfectants suggested on the labels proved

to be a significant problem. (See references # 16-17, pages

App. 161-170). Of 15 recommended dilutions, 14 (93%)

required more time than stated on labels to kill poliovirus

and the TB bacteria. Five required hours longer than the

times stated, with two requiring five hours longer than

«

¥

+

-

Ed

4

cs

15

times stated on the labels. Since 1991 when CRA per-

formed this work, FDA has attempted to correct this

problem and has eliminated the worst discrepancies, but

some problems still exist with kill-time label claims on

some products. Ironically, if clinicians are willing to allow

any amount of time, up to six hours, for disinfection to

take place, CRA data showed all the products tested

eventually killed the test organisms adequately.

CRA submits that even the most potent disinfectants,

known as “high level disinfectants”, now regulated under

the auspices of FDA, have not provided protection

expected by clinicians, leaving them subjected to signifi-

cant potential for disease transmission, while creating the

illusion of protection.

5. Sterilization Equipment (See reference # 18,

pages App. 171-184).

Heat sterilization equipment is one area of infection

control products where governmental control (FDA clear-

ance) has been very strict, and proof of a substantial

margin of safety has been required. However, the deci-

sion to “grandfather” some sterilizers sold before 1976,

and still sold today, presents problems because they have

not been subjected to the same performance criteria.

However, the biggest problem in the dental sterilizer

market is dental drill sterilization. It has been shown that

dental drills generally require a little more time to render

them sterile than the conventional hand instruments,

such as mouth mirrors and “picks” used by dentists.

Therefore, FDA requires a separate submission and con-

firmatory data for dental drill sterilization.

16

Unfortunately, dental clinicians are totally ignorant

of this requirement. Clinicians purchase and use their

sterilizers for all instruments, including dental drills.

There is no realization by clinicians that the dental drills

may require a longer time to be rendered sterile.

In the summer of 1998, a researcher shocked the

dental community by reporting that several models of

chemical vapor sterilizers did not render dental drills

sterile. (See reference # 18, pages App. 171-184). He dem-

onstrated lack of sterility by recovering viable test spores

within the dental drills. CRA then examined the U.S.

dental sterilizer market and found that five of ten popu-

lar dental sterilizers (50%) had not received 510K clear-

ance for handpiece sterilization, even though

manufacturers and distributors of these sterilizers knew

that dental clinicians were likely to use the sterilizers to

treat dental drills.

Therefore, sterilization times for dental drills pro-

cessed in the five sterilizers yet to be cleared are

unknown. The clinical risk related to this fact can only be

surmised.

Because of the significant risk that exists under the

universal precautions protocol, at a minimum Dr. Brag-

don should have been allowed to present evidence such

as that contained herein to the finder of fact. The First

Circuit erred in affirming the summary judgment in favor

of Respondents.

4a SON ss cant athe PRD tes hah De RE NM

17

CONCLUSION

CRA has addressed the term “significant risk” as it is

used in the Americans with Disabilities Act related to

dental clinical treatment of HIV positive and AIDS

patients. Data and comments presented are meant to

address testimonies of experts in this case who declared

that no protective measures beyond those known as “uni-

versal precautions” are necessary to secure dental clini-

clans against transmissions during treatment. CRA has

submitted a body of data generated by our lab and others

to show that the products necessary to implement the

universal precautions concept (face-masks, latex gloves,

disinfectants, and sterilizers) are defective even when

fresh, new and unused. CRA submits that when the prod-

ucts fail to block or kill as expected, the universal precau-

tions concept is negated, and clinicians who operate

thereunder are exposed to significant risk. The situation

is analogous to requiring every infantry person to carry

into battle a rifle that is known to have a defective trigger

that allows the gun to be fired sometimes, as expected,

but jams sometimes without warning. Would anyone dis-

agree that the soldiers were at risk of getting shot and

maybe killed when their gun jammed and the enemy got

off the first shot?

To place people infected with a virus transmitted by

their blood and other body fluids into routine main-

stream healthcare, and then disallow any special precau-

tions simply invites catastrophic incidents from time to

time, without any way to predict exactly when a care-

giver will become infected. The nature of viral transmis-

sion is generally haphazard unless the virus is particu-

larly virulent and/or the immunity pool is nonexistent.

18

Therefore, all exposure incidents may not lead to infec-

tion and disease, and the courts may be tempted to play a

numbers game to determine significance of the risk. The

unfortunate part of this approach is that the infection is

exquisitely significant to the caregiver infected, and pos-

sibly also to the index patient involved in the transmis-

sion. The point is, we now have two infected individuals

instead of just the original one. If we wanted to play a

numbers game, we could say we just doubled the original

number of infected people, and doubling of a number is

considered a significant increase to most people.

CRA’s data indicate there is significant risk, not over-

come by universal precautions, every time HIV positive

patients receive treatment where bleeding tissue and use

of sharp instruments is involved.

Is it safer for dentists to treat HIV positive patients in

a hospital? The answer to this question is both yes and

no. No, it probably does not make a difference to the

safety of the infected patient. YES, it could be safer to the

uninfected clinicians because, in the event of a clinical

accident, within the hospital they can receive immediate

prophylactic treatment. Prophylactic treatment involves

administration of drugs not readily available just any-

where. Ideally, post-exposure drugs should be adminis-

tered immediately after exposure to allow the best chance

of effectiveness. In suburbs and rural areas, after acci-

dent, clinicians may have to lose precious time traveling

to centers where these drugs are available. In some cases,

the travel could involve a delay of many hours, which

could diminish chances of a positive outcome.

Ra Nik Ny tas hea RL Cleese Ais sable are eal

19

Analysis of Dr. Bragdon’s petition should focus on

control of infectious diseases. While unfounded discrimina-

tion is improper under the ADA and within our society,

when there exists a significant threat to the life of a

caregiver the law should not prevent the caregiver from

taking all reasonable precautions. The data presented

herein show that significant risk exists every time clini-

clans treat an infected patient using the defective

defenses of the universal precautions protocol. This risk

is escalated exponentially when an accident or mistake

occurs that causes further compromise of universal pre-

cautions produets, which are highly questionable from

the onset.

Theoretically, the products that support the universal

precautions concept should provide the protection

sought, in the absence of any accidents that compromise

them. But, in actuality, the infection control products

provide no more than a show to reassure patients that the

personnel treating them are aware of, and concerned

about, transmission of diseases, and to reassure clinicians

by placing a shield or barrier between their body and

infectious materials. But any thinking clinician realizes

the protection is weak and minimal and easily penetrated

in a split second of an unfortunate move. Most clinicians

and patients (and, for that matter, the experts who testi-

fied in this case), are unaware of the flaws in masks,

gloves, disinfectants, and sterilizers, which we have

reported here. Based on the evidence herein, to say or

imply that universal precautions products are enough to

remove significant risk of viral transmission during treat-

ment of HIV positive patients is wishful thinking at best,

20

and reckless disregard for the health and lives of care-

givers and other patients at worst.

Respectfully submitted,

RicHarD L. Hitt

Counsel of Record for Amicus Curiae

Clinical Research Associates

Jamestown Square

3319 North University Avenue

Suite 200

Provo, Utah 84604

(801) 375-6600

WAI PUN Saati Thiel

ply ipl.

App. 1

REFERENCE NO. 1

The Boston Globe - Tuesday, April 6, 1999

A nurse hopes her infection will spur action

By Richard A. Knox

Globe Staff

Nurse Karen Daley was shoving a used hypodermic

needle into a disposal box at the Brigham and Women’s

Hospital emergency room last July when she felt a sharp

pain. A used needle inside the box was pointing upward,

and it stuck her gloved finger.

Months later she got the awful news: The accidental

needle-stick injury had infected her with the viruses that

cause AIDS and hepatitis C, a serious and often fatal liver

disease.

US health-care workers report about 600,000 acciden-

tal injuries from needles and other “sharps” each year,

resulting in about 1,000 serious infections. What made

Daley’s case unique is that she is president of the Massa-

chusetts Nurses Association.

Ironically, the association was already preparing leg-

islation that would require hospitals to use the best avail-

able needle stick prevention technology.

To further the cause, the 46-year-old nurse pians to

reveal her infection publicly today in Beacon Hill testi-

mony.

App. 2

“She’s one amazing person,” said Gloria Craven, the

association’s lobbyist. “She’s saying ‘How can we turn

this into something good?’”

Daley declined to speak about her situation before

her testimony, but colleagues say she is coping with

stoicism and determination. She reportedly suffers

serious fatigue from her infections.

Through June of last year, the US Centers for Disease

Control recorded 54 cases of documented HIV infection

among health-care workers and 133 possible cases.

Nurses led the list of workers with occupationally

acquired HIV infection.

It is rare for victims of accidental needle sticks to

become infected with both hepatitis C and the human

immunodeficiency virus (HIV), which causes AIDS. Both

are potentially fatal, and hepatitis C is the leading cause

of liver failure requiring transplantation.

The dual infection complicates Daley’s treatment, a

nurse colleague said, and makes it difficult to predict her

course.

Although details of Daley’s injury were unavailable

yesterday, it may have been impossible to identify the

patient who was the source of her infections. The disposal

box presumably contained needles for a variety of

patients treated that day.

One of Daley’s colleagues called her injury “100 per-

cent preventable” by such means as better-designed dis-

posal boxes, more frequent emptying of such receptacles,

and needles that are covered by a retractable plastic

—

RR Meters ht Le eee eng hr eee

App. 3

sheath except at the moment when they are in contact

with a patient’s skin.

“Overall the health-care industry has not seen fit to

provide the devices that would make the work environ-

ment safer for nurses and others,” said Evelyn Bain, an

occupational safety and health specialist at the nurses

association.

The costs of safer technology are far outweighed,

Bain said, by the costs of investigating needle-stick inci-

dents and providing prophylactic drugs costing $1,300 to

$1,800 per case, not to mention the future treatment costs

and human suffering if a health-care worker becomes

infected. “One local hospital that reduced needle-stick

injuries by 50 percent with a prevention program still

recorded 101 injuries in 1997,” she added. “That facility

spent $141,000 to follow the injured workers.”

The proposed legislation, which will be considered

by the Legislatures’s Joint Health Care Committee today,

would set up a mechanism within the state health depart-

ment requiring health-care facilities to employ best-avail-

able prevention strategies.

“Facilities would have to do only three things: pur-

chase the appropriate equipment; look at how to prevent

injury; and when an injury occurs, document it and keep

a log so we can use it for quality improvement,” Craven

said.

So far Oregon is the only state to pass such a law, she

said.

Judy Glasser, a spokeswoman for the Massachusetts

Hospital Association, said hospitals generally support the

App. 4

proposal. “We believe it moves in the right direction, and

we believe we should do everything we can to protect our

employees and caregivers,” Glasser said.

Staff members at the nurses association said they

learned only about a month ago about Daley’s infections,

which the administration of prophylactic drugs had failed

to prevent. “Most of us haven't stopped crying yet,” one

said.

Daley’s career may not be over, but her 25 years of

direct patient care may be at an end because of the risk

she may pose to patients. About 85 percent of individuals

infected with hepatitis C virus become chronic carriers,

and so far no treatment has been shown to eliminate HIV

from the tissues of infected individuals.

App. 5

REFERENCE NO. 2

United States General Accounting Office

Report to Congressional Requesters

August 1990

DISINFECTANTS: EPA Lacks Assurance They Work

GAO/RCED-90-139

Executive Summary

Purpose Disinfectants — about a $1 billion per

year market — are used to kill germs

on inanimate surfaces and objects in

hospitals, schools, restaurants, and

homes. Because users cannot see

whether disinfectants kill bacteria,

fungi, and viruses, the use of inef-

fective disinfectants poses a threat

to public health and wastes con-

sumer dollars.

Mounting concerns about whether

hospital and household disinfectants

work as claimed and the adequacy

of the Environmental Protection

Agency’s (EPA) disinfectants pro-

gram led the House Committee on

Government Operations to request

that GAO review EPA’s regulation of

the efficacy of disinfectants.

Background Under the Federal Insecticide, Fun-

gicide, and Rodenticide Act

(FIFRA), EPA generally must regis-

ter (license) pesticide products,

including disinfectants, before they

Results in Brief

App. 6

are marketed. EPA may register a

pesticide product only if EPA deter-

mines that it is effective, when used

as claimed, without causing an

unreasonable risk to health or the

environment. For most pesticides,

EPA allows the marketplace to regu-

late product performance (efficacy)

because users can see whether the

pesticide is effective against the tar-

get pest. However, registrants of

disinfectants intended to protect

public health must submit efficacy

data to substantiate each product

performance claim and use.

Until 1982, EPA conducted limited

preregistration confirmatory and

post-registration enforcement tests

on disinfectants at its laboratory

facilities in Beltsville, Maryland.

EPA discontinued disinfectant test-

ing in 1982 primarily because of

budget constraints. Currently, EPA

relies on its review of registrant-sub-

mitted efficacy data to register disin-

fectants. As of September 1, 1989,

about 4,100 disinfectants for public-

health use were registered with EPA,

representing about 18 percent of

approximately 23,000 registered

pesticide products.

EPA does not know whether disin-

fectants kill the germs claimed on

product labels for four reasons.

First, although the validity of

App. 7

methods and performance standards

used to assess the efficacy of disin-

fectants has been the source of sci-

entific controversy for over a

decade, EPA does not independently

test disinfectants before registering

them and lacks criteria to assess the

validity of registrant-proposed test

methods and modifications. Second,

EPA has made little progress in

resolving these controversies

because of budget constraints and

inadequate research management.

Third, EPA lacks sufficient internal

controls to ensure the quality and

integrity of the data that registrants

submit on disinfectant efficacy.

Fourth, EPA lacks an enforcement

Strategy to ensure that, once regis-

tered, disinfectants sold and distrib-

uted in the marketplace work as

claimed.

The extent to which ineffective dis-

infectants are marketed is unknown.

Although the scientific controversies

cloud the issue somewhat, evidence

from EPA, the states, and others

suggests that up to 20 percent of

disinfectants on the market may be

ineffective.

Principal Findings

Validity of Test Methods

EPA lacks assurance that the test

methods and performance standards

App. 8

used by registrants to substantiate

disinfectant efficacy claims are

valid. EPA primarily relies on stan-

dard-setting organizations, such as

the Association of Official Analytical

Chemists (AOAC) and the industry

itself to develop test methods and

performance standards. However,

these methods and standards have

been embroiled in scientific contro-

versies for over a decade. For exam-

ple, scientists have debated whether

the AOAC Use-Dilution Method, the

most widely used test method, is

reproducible, accurate, and precise,

and whether the performance stan-

dard (pass/fail criterion) established

by EPA is valid. Although EPA

believes that the existing methods

and standards are acceptable for

registering and enforcing disinfec-

tant efficacy claims, the controver-

sies have impaired the credibility of

the disinfectant program. An ad hoc

industry/state group recently has

developed a test method to replace

the AOAC Use-Dilution Method and

is expected to present the results of

its research to the AOAC in Septem-

ber 1990. EPA officials believe that

the new method is reproducible and

reliable and will consider whether to

require that disinfectants be retested

using it after AOAC considers it for

adoption.

EPA has contributed to the contro-

versies by accepting test methods

App. 9

and modifications without criteria

and independent laboratory data for

evaluating their validity. For exam-

ple, EPA accepts three different test

methods to demonstrate that disin-

fectants kill tuberculosis bacteria. At

least one product tested under two

of the methods produced substan-

tially different results. Although

EPA has registered the product on

the basis of one of the methods, EPA

lacks the laboratory information

needed to explain the differences in

results between the methods.

Although EPA has been aware of the

scientific controversies for years, it

has made little progress in resolving

them because of problems in con-

ducting needed research. EPA’s

6-year, $384,000, cooperative agree-

ments with the University of North

Carolina did not fulfill EPA’s

research objectives to improve disin-

fectant efficacy methods because

EPA inadequately managed the

agreements. EPA has also made little

progress in conducting additional

research because of budget con-

straints. In April 1990, EPA

announced that it would spend

$600,000 for research on certain dis-

infectant efficacy methods and esti-

mated an additional $1.2 million

will be needed.

App. 10

Controls Over Quality and Integrity of Data

To ensure the quality and integrity

of registrant-submitted disinfectant

data, EPA reviews the data prior to

registration and performs laboratory

inspections and data audits. GAO,

however, found internal control

weaknesses in these programs. For E

example, EPA has not inspected the E.

majority of labs that have performed .

disinfectant efficacy studies. In fact, :

EPA was aware of only 12 of the 92

labs that had performed these

studies. Although these programs

need to be improved they, in them-

selves, are not an adequate substi-

tute for a preregistration program to

selectively test disinfectant efficacy :

by an independent laboratory. Data 3

reviewers, lab inspectors, and data

auditors generally cannot identify

cases in which registrants have

selectively submitted data indicat-

ing that their disinfectants work

because they generally do not F

observe the tests in progress and no

physical evidence remains from the

tests conducted.

ih yell ii Mie aiac dk rb Cs lei s Bilat

Monitoring and Enforcement of Marketed Disinfectants

EPA’s registration process by itself

cannot provide assurance that disin-

fectants are effective because regis-

trants could market ineffective

batches, either intentionally or inad-

vertently, after registering them.

App. 11

However, EPA does not enforce the

efficacy claims of disinfectants on

the market. EPA discontinued its

limited enforcement testing program

in 1982 primarily because of budget

constraints. Since 1982, EPA has

looked to the states, user groups,

and the industry to enforce efficacy

claims. However, GAO found few

states and no users monitoring dis-

infectant efficacy because of cost

concerns. Only five states test disin-

fectants for efficacy, and these states

have limited programs. Moreover,

EPA lacks a strategy to channel com-

plaints about potentially ineffective

disinfectants from the states, user

groups, and the industry and to take

appropriate enforcement action

against disinfectants found to be

ineffective. Although EPA needs to

resolve the scientific controversies

that surround disinfectant efficacy

test methods and performance stan-

dards, these controversies should

not prevent EPA from developing an

enforcement strategy, in conjunction

with the states, user groups and

industry, to ensure that marketed

disinfectants work as claimed. Pub-

lic health and consumer welfare may

be comprised without such assur-

ance.

Recommendations

GAO is making recommendations to

the Administrator, EPA, to correct

deficiencies and restore credibility

App. 12

in the disinfectant program, includ-

ing (1) developing a plan to resolve

the scientific controversies that sur-

round disinfectant efficacy test

methods and performance stan-

dards; (2) developing and publish-

ing a policy that establishes criteria

for evaluating the validity of new

test methods and modifications,

including criteria for determining

when independent laboratory data

are needed for validation; (3)

improving internal controls over its

current programs to ensure the qual-

ity and integrity of registrant-sub-

mitted efficacy data and conducting

preregistration tests to selectively

verify registrant claims; (4) estab-

lishing an enforcement strategy in

conjunction with the states, user

groups, and industry to ensure that

marketed disinfectants work as

claimed; and (5) preparing a cost-

benefit analysis of alternatives for a

laboratory facility to research and

test the efficacy of disinfectants,

including the option of charging

fees to register disinfectants to help

finance such a facility.

Agency Comments

GAO did not obtain official agency

comments on this report. GAO did,

however, discuss the factual content

of the report with EPA officials and

has included their comments where

appropriate. EPA officials generally

agreed with the accuracy of the facts

PEE RCs ee ee

App. 13

but believed that, as presented, the

report could be misread and sug-

gested changes for presenting the

facts. GAO made some revisions to

the report on the basis of EPA’s com-

ments. GAO believes that the report

is a fair and accurate presentation of

the issues.

App. 14

REFERENCE NO. 3

New York Times, March 22, 1994

Investigating a Medical Maze: Virus Transmission in

Surgery

Hepatitis B was apparently spread by a doctor, but how?

By LAWRENCE K. ALTMAN, M.D.

In a cluster of cases that has mystified medical detec-

tives, 18 patients who underwent heart surgery at two

hospitals associated with the University of California at

Los Angeles over a 10-month period in 1991 and 1992

developed hepatitis B several weeks after their opera-

tions.

The sleuths believe they know who the carrier of the

virus was: a surgeon. But only after more than a year and

a half of investigation do they have a clue as to how the

patients became infected.

By reviewing medical records, interviewing doctors

and patients and testing their blood, epidemiologist

traced the cluster in July 1992 to a surgeon-in-training

who had not been immunized against the viral liver

infection. Over the 10 months, the surgeon, who has not

been identified, had been involved in operations on 142

patients at both the \U.C.L.A Medical Center and the

Wadsworth Veterans Administration Hospital. Of these,

18, 13 percent developed hepatitis B infection. Of at least

155 patients operated on by other surgeons at the two

hospitals, none developed hepatitis B.

App. 15

A team of experts from the Federal Centers for Dis-

ease Control and Prevention in Atlanta, U.C.L.A. and the

Los Angeles County Health Department tested as many

of the 18 patients as they could, and found that in every

one the virus was identical to that of the surgeon. The

team reported its findings at a meeting in Atlanta last

month.

The evidence was so compelling that the doctor

stopped working as a surgeon as soon as the cluster was

detected. He is now working in the operating room of an

unidentified hospital and not performing surgical pro-

cedures, according to Dr. James Cherry, a U.C.L.A. hospi-

tal epidemiologist and an author of the report.

The doctor had presumably been infected by a

patient, whom the detectives were not able to identify. It

takes about six months from the time of exposure before

symptoms, including fatigue and jaundice develop. In the

doctor’s case, this occurred about halfway through a

period in which the patients were infected. The epidem-

iologist suspect he infected some patients while incubat-

ing the disease.

The doctor was tested, found to have hepatitis B and

was permitted by the hospital to return to surgery after

about two weeks, even though he was now a carrier of

the virus.

The sleuths had solved one dimension of the out-

break. Still, a mystery remained: how did the surgeon

transmit the virus to so many patients?

He did not recall having stuck himself with a needle

or sharp instrument. If such a puncture tore his glove, a

App. 16

few drops of virus-contaminated-blood could have leaked

into a patient’s body. This is also the way the surgeon

himself might have become infected, though by the time

he developed symptoms six months later, he had no

recollection of any such incidents.

But as Dr. David M. Bell, an expert on hospital infec-

tions for the Centers for Disease Control and Prevention

and a co-chairman of the meeting pointed out, the sur-

geon would have had to injure himself scores of times to

infect so many patients, Colleagues had not noticed that

the surgeon’s operating-room techniques were flawed or

sloppy.

After spending months pursuing many leads without

conclusively identifying a specific mechanism for trans-

mitting the virus, the epidemiologist decided to pick up

on one of the surgeon’s own suggestions.

“He mentioned that when he operates, on occasion

his fingers would become irritated, and he speculated

that perhaps the pressure of tying sutures might have

something to do with the transmission” of the virus, said

Dr. Rafael Harpaz, a CDC epidemiologist who headed the

team, in an interview.

So the surgeon cooperated in a simulation of his

surgical technique. In a sort of surgical marathon, he tied

knots for an hour, far more than he would do in a real

operation. When he finished the simulation, his fingers

were bruised. The inside of each glove was washed, and

the washings were sent to a laboratory. To the investiga-

tors’ surprise, virus was found in the washings, offering a

possible explanation of how the surgeon might have

transmitted the virus to his patients: it might have

tence pesos lll

* ———

App. 17

escaped through tiny holes in his surgical gloves, the

result either of manufacturing imperfections or tears from

use.

Surgeons often note minor bruising from suturing

and the pressure of holding instruments, but they gener-

ally do not equate such irritations with the seriousness of

an accidental glove puncture from a needle, sharp instru-

ment or piece of bone.

It takes just a few drops of hepatitis B-contaminated

blood to be infectious. Studies show that the risk of

transmitting hepatitis B from a needle stick is about 100

times as great as the risk of transmitting the AIDS virus.

Transmission of hepatitis from an infected patient to

a health care worker is not unusual. But Dr. Harpaz said

the Los Angeles cluster is one of just seven reported

worldwide since 1987 of transmission in the other direc-

tion, affecting some 44 patients altogether. Ability to

transmit hepatitis B correlates strongly with the presence

of the so-called e antigen in the blood. The antigen often

remains but can disappear over time.

In several of the clusters, health officials were not

able to determine how the hepatitis virus had been trans-

mitted to a patient. They assumed that the doctor was

sloppy and violated standard infection-control practices.

But Dr. Bell of the CDC said that there was little scientific

data to support this assumption and that “we need to re-

examine it in light of the findings” from the Los Angeles

cluster.

In none of the other cases were simulations and

laboratory studies used to study how transmission might

App. 18

have taken place. Dr. Harpaz said, while Dr. Bell and

other experts cautioned against generalizing from the Los

Angeles cluster unti! additional studies are done, he said

that if the finding is confirmed, he hoped it could lead to

improving gloves to help prevent transmission.

Although the spread of hepatitis B has never been

linked to sweat, participants at the meeting suggested

this might be a mode of transmission. If so, they specu-

lated that contaminated sweat could leak through a hole

in surgical gloves into a patient’s body, thus posing a

previously unrecognized risk.

Like HIV, the virus that causes AIDS, the hepatitis B

virus is transmitted by blood and through sexual contact.

But unlike HIV, hepatitis B can be prevented by a vaccine.

Dr. Craig Shapiro of the Centers for Disease Control,

who is an author of the Los Angeles study, said that until

recent years, an estimated 250 health care workers a year

developed hepatitis B and eventually died from it. The

figure now is about 100 a year, in part due to a recom-

mendation in 1991 from the Federal Occupational Safety

and Health Administration that surgeons and other

health care workers be immunized to prevent hepatitis B

infection.

One puzzle in the Los Angeles outbreaks is why the

surgeon had refused the vaccine, which would have pro-

tected himself and his patients. Because health officials

have not identified him, there is no way to ask him why

he had not been vaccinated to protect himself and his

patients. But Dr. Cherry of U.C.L.A. said the surgeon had

been offered the vaccine at a hospital he had worked at

before coming to U.C.L.A.

App. 19

Dr. Quentin R. Stiles, a retired chest surgeon in Los

Angeles who is a spokesman for the American College of

Surgeons, said ”A lot of surgeons are like that, mostly

older ones,” in declining to take the very immunization

that they recommend to their patients. He characterized

these older surgeons as “a very reluctant bunch” in

changing their ways.

Because of their exposure to blood, surgeons run a

particular occupational risk of getting hepatitis B. Yet the

college has not conducted a survey to determine how

many surgeons have taken the series of three hepatitis B

shots. The vaccine has been available since 1981.

Dr. Stiles recently told a group of surgeons that they

face a greater risk from hepatitis B than from HIV. When

he asked how many in the audience had been immunized

against hepatitis B, fewer than half said they had, and

most of them were younger surgeons. Immunizing sur-

geons against hepatitis B “is the kind of thing we ought

to be insisting upon,” Dr. Stiles said.

In 1992, the Association of American Medical Col-

leges in Washington recommended that all medical stu-

dents be immunized against hepatitis B before their first

contact with patients and with blood products and

human tissue. Immunization is of no benefit after infec-

tion with the virus. The association has not conducted a

survey to determine compliance with the recommenda-

tion.

While the hospital’s decision to allow the doctor to

keep on operating even after he was found to be infected

with the virus may seem unusual, it is in compliance with

Federal guidelines. These call for local committees to

-

App. 20

decide whether an infected surgeon can continue operat-

ing or performing procedures in which patients could be

exposed to infected blood. In deciding, the committee

evaluates a number of factors that might bear on the risk

of transmission, like the skill of the worker and the kinds

of procedures that the individual performs.

Health officials are aware that nothing less than the

doctor’s career is at stake in the decision.

The policy of the Los Angeles County Health Depart-

ment, according to Dr. Shirley L. Fannin, an official of the

department, is to allow infected doctors to continue

working. But the doctor is informed that if one case of

transmission is detected, limitations will be imposed on

his practice.

App. 21

REFERENCE NO. 4

The New England Journal of Medicine

©Copyright, 1996, by the Massachusetts Medical Society

Volume 334 February 29, 1996 Number 9

TRANSMISSION OF HEPATITIS B VIRUS TO MULTI-

PLE PATIENTS FROM A SURGEON WITHOUT EVI-

DENCE OF INADEQUATE INFECTION CONTROL

RAFAEL HARPAZ, M.D., LORENZ VON SEIDLEIN,

M.D., FRANCISCO M. AVERHOFF, M.D., M.P.H.,

MICHAEL P. TORMEY, M.P.H., SASWATI D. SINHA, B.S.,

KONSTANTINA KOTSOPOULOU, M.D., STEPHEN B.

LAMBERT, M.S., BETTY H. ROBERTSON, PH.D., JAMES

D. CHERRY, M.D., MSc., AND CRAIG N. SHAPIRO,

M.D.

Abstract Background. Although about 1 percent of sur-

geons are infected with hepatitis B virus (HBV), transmis-

sion from surgeons to patients is thought to be

uncommon. In July 1992, a 47-year-old woman became ill

with acute hepatitis B after undergoing a thymectomy in

which a thoracic-surgery resident who had had acute

hepatitis B six months earlier assisted.

Methods. To determine whether the surgeon transmit-

ted HBV to this patient and others, we conducted chart

review, interviews, and serologic testing of thoracic-sur-

gery patients at the two hospitals where the surgeon

worked from July 1991 to July 1992. Hepatitis B surface

antigen (HBsAg) subtypes and DNA sequences from the

surgeon and from infected patients were determined.

Results. Of 144 susceptible patients in whose surgery

the infected surgeon participated, 19 had eyidence of

recent HBV infection (13 percent). One of the hospitals

App. 22

was selected for additional study, and none of the 124

susceptible patients of the other thoracic surgeons at this

hospital had evidence of recent HBV infection (relative

risk, «; 95 percent confidence interval, 4.7 to ©). No

evidence was found for any common source of HBV other

than the infected surgeon. The HBsAg subtype and the

partial HBV DNA sequences from the surgeon were iden-

tical to those in the infected patients. Transmission of the

infection was associated with cardiac transplantation (rel-

ative risk, 4.9; 95 percent confidence interval, 1.5 to 15.5)

but not with other surgical procedures. The surgeon was

positive for hepatitis B e antigen and had a high serum

HBV DNA concentration (15 ng per milliliter). Our inves-

tigations identified no deficiencies in the surgeon's infec-

tion-control practices.

Conclusions. In this outbreak there was surgeon-to-

patient HBV transmission despite apparent compliance

with recommended infection-control practices. We could

not identify any specific events that led to transmission.

(N Engl J Med 1996;334:549-54). ©1996, Massachusetts

Medical Society.

APPROXIMATELY 24 million operations are performed

annually in U.S. hospitals by an estimated 133,000 sur-

geons.! The Centers for Disease Control and Prevention

(CDC) estimate that 1900 U.S. surgeons are chronically

infected with hepatitis B virus (HBV), but reports of

surgeon-to-patient transmission of the virus are uncom-

mon.2 Transmission of HBV to patients has been associ-

ated with health care workers with highly infectious

disease who were positive for hepatitis B e antigen

(HBeAg) and has generally involved breaches in standard

infection-control practices, although correction of these

App. 23

deficiencies has not always prevented additional

instances of transmission.*© We report an outbreak of

HBV infection associated with an HBV-infected thoracic-

surgery resident and suggest potential mechanisms of

transmission.

METHODS

In July 1992, a 47-year-old woman without identified

risk factors became ill with acute hepatitis B four months

after undergoing a thymectomy in which a thoracic-sur-

gery resident participated. This surgeon was found to be

susceptible to HBV on testing in December 1989 before

completing a general-surgery residency elsewhere. He

began the thoracic-surgery residency program in July

1991 after a year of research. He was offered the hepatitis

B vaccine but never received it. In January 1992, he

became fatigued, and in February he had jaundice with

detectable hepatitis B surface antigen (HBsAg) and IgM

antibody to hepatitis B core antigen (anti-HBc). He with-

drew from surgical duty until March 1992, when his

symptoms resolved, and he returned to practicing sur-

gery having had no additional tests for HBsAg or HBeAg.

He was still positive for HBsAg and HBeAg in July 1992,

when the index patient was identified, and was relieved

of surgical duties pending an investigation.

To determine whether other patients were infected

with HBV, we obtained blood specimens in September

1992 from patients operated on by the surgeon during the

study period, July 1991 to July 1992. The surgeon worked

at two hospitals during this period, referred to here as

Hospital A and Hospital B. For specimens collected

App. 24

within six months after surgery, we asked susceptible

patients to provide second specimens six months or more

after surgery to permit the detection of later seroconver-

sion. Chart reviews and interviews of patients or their

parents were conducted with standardized forms; demo-

graphic data and information about surgical characteris-

tics, prior HBV infection, and community risk factors for

infection were recorded. Sexual and household contacts

of infected patients were tested to exclude them as

sources of transmission. Patients were defined as having

acute HBV infection (case patients) if they were IgM anti-

HBc-positive or if they were seronegative within the year

before surgery or on initial testing and positive for

HBsAg or anti-HBc on final testing.

Retrospective Cohort Studies

A retrospective cohort study was conducted at Hos-

pital A to determine whether the surgeon had transmit-

ted HBV to the index patient and possibly others. We

compared the risks of infection among patients he oper-

ated on and among patients who underwent thoracic

surgery without his participation from November 1991 to

July 1992. Patients who had thoracic surgery without the

surgeon’s participation were contacted by letter and fol-

low-up telephone call and asked to provide demographic

information and serum for evaluation. This retrospective

cohort study included all patients who underwent tho-

racic surgery during the months when the surgeon was

not working at Hospital A and every third patient of

other thoracic surgeons during the months when he was

working there.

App. 25

A second retrospective cohort study evaluated risk

factors for infection among the patients the surgeon oper-

ated on at Hospital A, where data were more complete.

The study period was the same as that of the first retro-

spective cohort study. Data regarding characteristics of

operations and surgical procedures were collected with

standardized forms.

Additional information was collected by informally

interviewing the surgeon, operating-room personnel (tho-

racic-surgery fellows, attending physicians, anesthesiolo-

gists, scrub nurses, and perfusionists), and nurses in the

intensive care unit. The work schedules of nurses, phle-

botomists, and respiratory therapists were reviewed for

possible opportunities for transmission by circulating

hospital personnel. The vaccination records and the

results of serologic tests for HBV of operating-room per-

sonnel were reviewed, as were records of transfusions in

patients. Testing was conducted at the CDC for HBsAg

and antibody to HBsAg (anti-HBs) by radioimmunoassay

and for anti-HBc and IgM anti-HBc by enzyme immu-

noassay (Abbott Laboratories, North Chicago, Ill.). In

several instances, samples were tested at local clinical

laboratories. Samples with detectable HBsAg were

analyzed for HBsAg subtype by enzyme immunoassay

with monoclonal antibodies.”

Analysis of Serum Samples

Serum from the surgeon, from the infected patients,

and from an unrelated, acutely and chronically infected

convenience sample of controls from the state in which

the outbreak occurred were subjected to amplification by

App. 26

the polymerase chain reaction (PCR) to detect HBV DNA.

Twenty microliters of serum was digested with proteinase

K solution for one hour at 65°C, followed by phenol-

chloroform extraction and alcohol precipitation. HBV1858

(5'ACTGTTCA-AGCCTCCAAGCTG3'), HBV2437

(5'TTGAGATCTTCTGCGACGCGGC3’), and 5 units

of Taq polymerase were added to the precipitate for

amplification (30 cycles consisting of denaturation at

95°C for 30 seconds, annealing at 55°C for 30 seconds,

and extension at 72°C for 45 seconds). The samples were

purified and the sequence of 160 bases in the core region

was determined with use of HBV1858P® or the ABI auto-

mated sequencer and dye terminators (Applied Bio-

systems, Foster City, Calif.). The sequences were analyzed

with the Pileup program, which performs progressive,

pairwise comparisons and plots the results in a dendo-

gram to indicate similarity of sequences.

The HBV DNA concentration in the surgeon’s serum

was determined by dot blot hybridization!® and by PCR

end-point dilution. Ten-fold serum dilutions were ampli-

fied by PCR and evaluated by agarosegel electrophoresis.

The threshold of HBV DNA detectability was compared

with that of similarly diluted serum containing 100 mil-

lion chimpanzee-infectious particles per milliliter.

Statistical Analysis

The relative risks and 95 percent confidence intervals

were calculated with the use of Epi Info!!; the associa-

tions between exposures and infection were assessed by

univariate and stratified analysis; and the significance of

differences in proportions was assessed by the chi-square

App. 27

test with the Mantel-Haenszel correction for independent

samples or with Fisher’s exact test.

RESULTS

Identification of Cases

The surgeon operated on 239 patients (162 at Hospi-

tal A and 77 at Hospital B) from July 1, 1991, through July

16, 1992. Twenty-eight patients died before the investiga-

tion; none had recognized evidence of hepatitis. Of the

remaining 211 patients, 184 (87 percent) were available

for initial serologic testing, with 170 (81 percent) tested

six months or more after surgery. Of these 170, 11

reported prior HBV infection or hepatitis B vaccination

and had markers consistent with their histories; they

were excluded from the analysis. Nineteen patients had

evidence of acute HBV infection, as indicated by the

presence of IgM anti-HBc or by anti-HBc seroconversion.

Fifteen additional patients had HBV serologic markers

but were negative for IgM anti-HBc and had no evidence

indicating the presence or absence of seroconversion;

seven of these patients had other risk factors for HBV

infection. For purposes of analysis, these 15 patients were

assumed to have been infected before surgery. The over-

all attack rate was therefore 13 percent (19 of 144) among

susceptible patients available for follow-up.

The 19 case patients with acute HBV infection ranged

in age from 14 months to 83 years (median, 51 years). Six

(32 percent) had symptoms of acute hepatitis, one of

whom required hospitalization. Three of the remaining

patients died of other causes. Chronic HBV infection

developed in 9 of the 16 surviving case patients (56

App. 28

percent); 3 of these 9 had been receiving immunosuppres-

sive therapy, and another was two years of age.

All 19 case patients or their parents reported no other

risk factors for HBV infection. Sexual and household

contacts of all but three patients underwent HBV testing;

none were HBsAg-positive. Of the 19 case patients, 15

had had surgery at Hospital A and 4 at Hospital B. The

procedures included coronary-artery bypass surgery

(eight), orthotopic heart transplantation (four), repair of

congenital heart defects (four), valve replacement (one),

thymectomy (one), and open-lung biopsy (one). The pro-

cedures occurred throughout the study period without

apparent clustering in time (Fig. 1), even after we con-

trolled for the number of susceptible patients undergoing

surgery each month (data not shown).

Determining the Source of the Outbreak

We conducted a retrospective cohort study to deter-

mine whether patients of other surgeons at Hospital A

had acute HBV infection: a sample of 280 of 510 such

patients who underwent surgery from November 1991

through June 1992 was selected for evaluation, including

all patients who underwent thoracic surgery at Hospital

A while the HBV-infected surgeon was not working there

and every third patient of other thoracic surgeons at

Hospital A while he was working there. Of these patients,

259 were alive; 124 consented to be tested, were deter-

mined to be susceptible at the time of surgery, and had

six-month follow-up data available (Table 1). None of the

124 had evidence of recent HBV infection. This result

contrasts with the 15 who had such evidence (14 percent)

ee Spe aE ae er ety hie see Ap et eee st che

Se

App. 29

among the 106 patients who were operated on by the

surgeon at Hospital A (Table 1) (relative risk, ~; 95 per-

cent confidence interval, 4.7 to ©).

The two cohorts did not differ significantly according

to age, sex, race, or the distribution of procedures (data

not shown), although the average duration of surgery

was longer for patients operated on by the infected sur-

geon than for patients operated on by other surgeons (5.4

vs. 4.5 hours; P<0.001). When patients undergoing tho-

racic surgery who had evidence of prior, but not recent,

infection were included in the analysis as case patients,

the difference in infection rates for the two cohorts

remained significant: 24 of the 115 patients operated on

by the infected surgeon were HBV-infected (21 percent),

in contrast with 7 of the 131 patients operated on by other

surgeons (5.3 percent) (relative risk, 3.9; 95 percent confi-

dence interval, 1.8 to 8.7).

Opportunities for transmission from other nosoco-

mial exposures were investigated. Twelve of 15 case

patients at Hospital A (80 percent) had received blood

transfusions, all from different donors. No other surgeon,

anesthesiologist, nurse, phlebotomist, or respiratory ther-

apist had documentation of HBV infection, and none

treated more than seven case patients. Transmission to

patients occurred at both Hospital A and Hospital B; the

surgeon was the only common factor at the two hospitals.

The HBsAg subtype from the surgeon and from 13 of

the 19 case patients at both hospitals for whom subtyping

could be performed was adw2. We amplified HBV DNA

from the surgeon, 9 case patients, and 19 unrelated com-

munity controls (7 with acute infection and 12 with

App. 30

chronic infection). The sequences from the surgeon and

the case patients were identical. The sequences from all

but 4 of the 19 community controls were different from

each other and from the sequence from the surgeon (Fig.

a

Evaluation of Surgery-Related Risk Factors for HBV

Infection

To identify risk factors for HBV infection, we con-

ducted a retrospective cohort analysis of the patients the

surgeon operated on at Hospital A (Table 2). The infec-

tion rates did not differ according to sex or age. The rate

was higher among whites than in other racial groups. The

infection rate was higher among patients who received

blood products during surgery or who had surgery last-

ing 5.5 hours or longer, but these differences were not

statistically significant. The surgeon’s patients underwent

a variety of surgical procedures, but the infection rate

was increased only among patients who underwent car-

diac transplantation (relative risk, 4.9; 95 percent confi-

dence interval, 1.5 to 15.5). This association remained

significant when the duration of the procedure and the

use of blood products were controlled for (data not

shown). The infection rates were not associated with

emergency (as opposed to elective) surgery, the use of a

perfusion pump or cell saver, the specific operating room,

or prior sternotomy. The analysis of these associations

was unchanged by the inclusion of the 15 patients with

serologic markers of HBV infection but without evidence

of recent seroconversion (data not shown).

oe be ide tl? ena

ae) nee le eee ape es

ee ae I PRT eee Oe ord ol ee

LF a ee Le ee

F ——=

App. 31

Additional Fact-Finding

The surgeon reported no risk factors for HBV infec-

tion and was unaware of any percutaneous exposure to

blood from HBV-infected patients. He indistinctly recal-

led only one or two needle sticks during the period under

investigation, and he reported no injuries from sternal

wires or other sharp objects. He reported that he always

handled sharp objects with an instrument and did not

blindly palpate suture needles. Although the surgeon

reportedly often applied hemostatic material to sternal

incisions with his gloved hands rather than with the

protection of a sponge (the usual practice of other sur-

geons at the two hospitals), he recalled no glove punc

tures from this procedure. He performed no invasive

procedures on case patients in the intensive care unit or

the recovery room.

Other surgical personnel attested to the surgeon’s

good technique. He was left-handed, which sometimes

interfered with the passing of instruments or simul-

taneous suturing by more than one surgeon. He did not

use double gloves, but after contracting hepatitis B he

modified his behavior by frequently changing gloves dur-

ing operations. All surgical staff members, including the

surgeon, reported that blood was routinely present on

their hands when they removed their gloves after an

operation, whether or not visible tears were present in

the gloves and regardless of the type of gloves used.

In previous years, the surgeon had had a skin irrita-

tion that resolved after he changed to the routine use of

hypoallergenic latex gloves. In addition, he had periodic

App. 32

pain over the radial side of the index fingers that he

attributed to shear forces from tying sutures.

The serum HBV DNA concentration in the surgeon

just after the index patient was identified was 15 ng per

milliliter. The serum was estimated by semiquantitative

PCR to contain 1 billion infectious particles per milliliter.

Discussion

The infected thoracic surgeon whom we studied

transmitted HBV to at least 19 patients during surgery.

No patients undergoing procedures performed by other

thoracic surgeons had evidence of recent infection. The

timing of the infections and the absence of other identi-

fied sources of infection among the case patients were

consistent with transmission from the surgeon during

surgery. The infections occurred at two different hospitals

without common equipment or staff members other than

the surgeon. The presence of HBsAg subtype adw2 in the

surgeon and in the 13 cases patients in whom the subtype

of the antigen could be determined is unlikely to have

occurred by chance alone.!? The DNA sequences of the

HBV core region from the surgeon and from all 9 case

patients who could be evaluated were identical and were

different from that of all but 4 of the 19 community

isolates.

Although reporting of HBV infection is not complete,

both outbreaks and sporadic transmission of HBV from

surgeon to patient appear to be uncommon. Evidence that

the risk is low is limited and includes retrospective

studies involving patients of infected health care

workers,!>!© two case-control studies of patients with

. ‘ 2 rer m aaah a al “lal i biceathe cia So sina

oe sa LR SR a ce . sessile eh tet ake ae = NE Ie gs Se 5 eg ee ee a TA he oF oe aa ae t => *

SA est 8S 2 SELLA PIER a RIS sa PPE ie ESS Ci ners ea: ’ : : ms

Baits NSS a aa RNa

App. 33

acute hepatitis B that found no @ssociation between dis-

ease and surgical history!” (and unpublished data), and

the relatively small number of reported outbreaks of HBV

given the estimated pool of infected surgeons.

Outbreaks provide information about specific mecha-

nisms of transmission of HBV from surgeon to patient.

Since the early 1970s, 29 such clusters have been reported

worldwide,?>.1%24 including 9 involving thoracic sur-

geons.*!%22-24 Data from these outbreaks indicate an

increased risk of HBV transmission from HBeAg-positive

surgeons and during particularly invasive pro-

cedures.°71-25 Transmission during many of these out-

breaks was presumed to be caused by deficiencies in

infection-control measures. Although this outbreak

involved a high attack rate, our investigation did not

identify any breaches in infection-control practices,

despite an extensive search for potential modes of trans-

mission. Unreported or unrecalled percutaneous expo-

sures by the surgeon or operating-room staff are unlikely

to explain such a high rate of transmission.

Although this is the first reported outbreak involving

a thoracic surgeon in the United States, four such out-

breaks have been reported in the United Kingdom during

the past decade.5?4 We found no specific features charac-

teristic of thoracic surgery that were associated with

transmission. Surgical fields are generally well visualized

during thoracic surgery, and blind needle palpation is not

often practiced. Thoracic surgery is, however, inherently

highly invasive and of long duration, and these features

have been linked to percutaneous exposure,*?8 glove

failure,2?3! and HBV transmission.2! Indeed, whether

caused by the duration of surgery or by specific factors

App. 34

such as the closure of sternotomy incisions, frequent

glove punctures during thoracic surgery have been

reported.*©253!.32 In this outbreak, there was no associa-

tion of HBV infection with the duration of surgery or the

use of blood products (a possible indication of the

invasiveness of a procedure); two case patients, in fact,

underwent brief procedures requiring no blood products

(a thymectomy and an open-lung biopsy). We found no

associations between HBV transmission and specific pro-

cedures, with the exception of cardiac transplantation,

although in relative terms these were not long or complex

procedures. Perhaps the minimal infectious inoculum of

HBV is lower for patients receiving immunosuppressive

therapy. Some surgeons have suggested that closure of

the median sternotomy incision is associated with injury,

although data to support this assertion are inconclu-

sive.4!32 In our study, the surgeon’s technique of apply-

ing hemostatic material to the sternal incision without a

sponge may have caused injuries that were not apparent.

However, one case patient underwent an open-lung

biopsy that did not involve a median sternotomy.

This outbreak may have been related more closely to

factors unique to the surgeon than to factors inherent in

thoracic surgery: indeed, lung biopsy is a procedure with

little resemblance to most other thoracic surgical pro-

cedures. Although HBeAg-positive persons almost

always have highly infectious disease, the surgeon had an

especially high concentration of HBV DNA during the

outbreak, which may have contributed to aq high risk of

transmission. The surgeon's technical skills were appar-

ently not a factor, since operating-room personnel did not

App. 35

recall that he had frequent needle sticks. The hand irrita-

tion experienced by the surgeon in previous years had

resolved with the use of hypoallergenic latex gloves, and

there was no evidence that the surgeon had dermatitis

during the outbreak. Hypoallergenic gloves are subject to

the same quality standards as standard surgical gloves.

The surgeon had pain over his index fingers during

prolonged suturing. Other surgeons have described simi-

lar experiences to us; we are unaware of any studies

addressing this phenomenon. While participating in a

one-hour simulation of suture tying,*’ the surgeon

acquired paper-cut-like lesions on his fingers, and HgsAg

and HBV DNA were isolated from washings of his hands.

Such lesions, combined with the failure of his gloves, may

have allowed contamination of patients with HBV.

Although gloves frequently have leaks during sur-

gery,2728,31,34,35 they nonetheless appear to be fairly effec-

tive barriers against certain infections, even when leaks

are present.*© Although there is increasing evidence that

double gloves can prevent exposure of surgeons to blood

during surgery,*> there is no evidence regarding the effec-

tiveness of double gloves in protecting patients from

blood-borne infections. Furthermore, advisory groups

and professional organizations have not generally recom-

mended the use of double gloves by surgeons. Additional

studies are needed to assess the validity and gener-

alizability of the suture-tying simulation and to define

the role of gloves in preventing the intraoperative trans-

mission of HBV.

This outbreak has had tragic consequences for the

case patients, their families, and the surgeon, who has left

surgical practice indefinitely. The entire episode could

App. 36

have been prevented had the surgeon received the hepa-

titis B vaccine.

We are indebted to Laurene Mascola, M.D., M.P.H.,

Michael Lim, M.P.H., Maria Rosario Araneta, Ph.D.,

M.P.H., Heidi Sato, M.P.H., and Alison Itano, M.S., for

their assistance during this investigation; to Carlton

Youngblood for performing the serologic tests; to Paul

Swenson, M.D., for performing HBsAg subtyping; to

Alan Redeker, M.D., for providing serum specimens from

HBV-infected persons for genotype analysis; to Susan

Govindarajan, M.D., for dot blot hybridization analysis of

specimens from the surgeon; to J. Shaw for editorial

assistance; to Miriam Alter, Ph.D., M.P.H., David Bell,

M.D., Mary Chamberland, M.D., M.P.H., Walter Bond,

M.S., Martin Favero, Ph.D., and Karin Lindsay, M.D., for

helpful suggestions; and to the thoracic surgeon

described in this report, for his cooperation and substan-

tial contributions.

REFERENCES

1. Hospital statistics: the AHA profile of United States

hospitals: 1994-95 edition. Sasa American Hospi-

tal Association. 1994.

2. Recommendations for preventing transmission of

human immunodeficiency virus and hepatitis B

virus to patients during exposure-prone invasive

procedures. MMWR Morb Mortal Wkly Rep

1991;40(RR-8):1-9.

3. Lettau LA, Smith JD, Williams D, et al. Transmission

of hepatitis B with resultant restriction of surgical

practice. JAMA 1986;255:934-7.

10.

aa:

12.

App. 37

Rimland D, Parkin WE, Miller GB Jr, Schrack WD.

Hepatitis B outbreak traced to an oral surgeon. N

Engl J Med 1977;296:953-8.

Heptonstall J. Outbreaks of hepatitis B virus infec-

tion associated with infected surgical staff. Commun

Dis Rep CDR Rev 1991;1:R81-R85.

Johnstone BL, MacDonald §S, Lee S. et al. Nosocomial

hepatitis B associated with orthopedic surgery -

Nova Scotia. Can Commun Dis Rep 1992;18:89-90.

Swenson PD, Riess JT, Krueger LE. Determination of

HBsAg subtypes in different high risk populations

using monoclonal antibodies. J Virol Methods

1991;33:27-38.

Robertson BH, Khanna B, Nainan OV, Margolis HS.

Epidemiologic patterns of wild-type hepatitis A

virus determined by genetic variation. J Infect Dis

1991;163:286-92.

Program manual for the GCG package, version 7.

Madison, Wis.: Genetics Computer Group, 1991.

Shafritz DA, Lieberman HM, Isselbacher KJ, Wands

JR. Monoclonal radioimmunoassay for hepatitis B

surface antigen: demonstration of hepatitis B virus

DNA or related sequences in serum and viral

epitopes in immune complexes. Proc Natl Acad Sci

U S A 1982;79:5675-9.

Dean AG, Dean JA, Burton AH, Dicker RC. Epi Info,

version 5: a word processing, database, and statistics

program for epidemiology on microcomputers.

Atlanta: Centers for Disease Control, 1990.

Dodd RY, Holland PV, Ni LY, Smith HM, Greenwalt

TJ. Hepatitis B antigen: regional variation in inci-

dence and subtype ration in the American Red Cross

donor population. Am J Epidemiol 1973;97:111-5.

13.

14.

15.

16.

ae;

18.

19.

20.

App. 38

Meyers JD, Stamm WE, Kerr MM, Counts GW. Lack

of transmission of hepatitis B after surgical expo-

sure. JAMA 1978;240:1725-7.

LaBrecque DR, Muhs JM, Lutwick LI, Woolson RF,

Hierholzer WR. The risk of hepatitis B transmission

from health care workers to patients in a hospital

setting — a prospective study. Hepatology

1986;6:205-8.

Alter HJ, Chalmers TC, Freeman BM, et al. Health-

care workers positive for hepatitis B surface antigen:

are their contacts at risk? N Engl J Med

1975;292:454-7.

Williams SV, Pattison CP, Berquist KR. Dental infec-

tion with hepatitis B. JAMA 1975;232:1231-3.

Alter MJ, Coleman PJ, Alexander WJ, et al. Impor-

tance of heterosexual activity in the transmission of

hepatitis B and non-A, non-B hepatitis. JAMA

1989;262:1201-5.

Prendergrast TJ Jr, Teitelbaum S, Peck B. Transmis-

sion of hepatitis B by a surgeon. West J Med

1991;154:353.

Bell DM, Shapiro CN, Ciesielski CA, Chamberland

ME. Preventing bloodborne pathogen transmission

from health-care workers to patients: the CDC per-

spective. Surg Clin North Am 1995;75:1189-203.

Carl M. Blakey DL, Francis DP, Maynard JE. Inter-

ruption of hepatitis B transmission by modification

of a gynaecologist’s surgical technique. Lancet

1982;1:731-3.

Welch J, Webster M, Tilzey AJ, Noah ND, Banatvala

JE. Hepatitis B infections after gynaecological sur-

gery. Lancet 1989;1:205-7.

App. 39

22. Coutinho RA, Albrecht-van Lent P Stoutjesdijk L, et

al. Hepatitis B from doctors. Lancet 1982;1:345-6.

23. Haerem JW, Siebke JC, Ulstrup J, Geiran O, Helle I.

HBsAg transmission from a cardiac surgeon incubat-

ing hepatitis B resulting in chronic antigenemia in

four patients. Acta Med Scand 1981;210:389-92.

24. Prentice MB, Flower AJE, Morgan GM et al. Infection

with hepatitis B virus after open heart surgery. BMJ

1992;304:761-4.

25. Hadler SC, Sorley DL, Acree KH, et al. An outbreak

of hepatitis B in a dental practice. Ann Intern Med

1981;95:133-8.

26. Tokars JI, Bell DM, Culver DH, et al. Percutaneous

injuries during surgical procedures. JAMA

1992;267:2899-904.

27. Gerberding JL, Littell C, Tarkington A, Brown A,

Schecter WP. Risk of exposure of surgical personnel

to patients’ blood during surgery at San Francisco

General Hospital. N Engl J Med 1990;322:1788-93.

28. Popejoy SL, Fry DE. Blood contact and exposure in

the operating room. Surg Gynecol Obstet 1991:

172:480-3.

29. Fell N, Hopper W, Williams J, Brennan L, Wilson C,

Devlin HB. Surgical glove failure rate. Ann R Coll

Surg Engl 1989;71:7-10.

30. Quebbeman EJ, Telford GL, Wadsworth K, Hubbard

S, Goodman H, Gootlieb MS. Double gloving: pro-

tecting surgeons from blood contamination in the

operating room. Arch Surg 1992;127:213-7,

31. Wong PS, Young VK, Youhana A, Wright JE. Surgical

glove punctures during cardiac operations. Ann

Thorac Surg 1993;56:108-10.

CC

nw

a

34.

35.

36.

App. 40

Pate JW. Risks of blood exposure to the cardiac sur-

gical team. Ann Thorac Surg 1990;50:248-50.

Harpaz R, Van Seidlein L, Averhoff FM, et al. Trans-

mission of hepatitis B virus from a thoracic surgeon

to patients. Infect Control Hosp Epidemiol

1994;15:352. abstract.

Hosie KB, Dunning JJ, Bailey JS, Firmin RK. Glove

perforation during sternotomy closure. Lancet

1988;2:1500.

Rose DA, Ramiro N, Perlman J, et al. Usage patterns

and perforation rates for 6306 gloves from intra-

operative procedures at San Francisco General Hos-

pital. Infect Control Hosp Epidemiol 1994;15:349.

abstract.

Olsen RJ, Lynch P, Coyle MB, Cummings J, Bokete T,

Stamm WE. Examination gloves as barriers to hand

contamination in clinical practice. JAMA 1993;

270:350-3.

App. 41

REFERENCE NO. 5

GENERAL DENTISTRY/NOVEMBER-DECEMBER 1991

Efficiency of 42 brands of face masks and 2 face shields

in preventing inhalation of airborne debris

Rella P. Christensen, PhD

Richard A. Robison, PhD

Daena F. Robinson, BS

Brad J. Ploeger, BS

Ronald W. Leavitt, PhD

Use of face masks by dental clinicians has increased

as a result of the AIDS epidemic.! In response to clini-

cians’ concerns about infectious disease transmission, the

American Dental Association (ADA) and Centers for Dis-

ease Control (CDC) issued recommendations for use of

preventive measures, including face masks, during dental

treatment.?° The use of face masks is now required by the

Occupational Safety and Health Administration

(OSHA).*5 However, none of these agencies provided

information on relative merits of different types of facial

barriers, which might give one the impression that all

facial barriers are equally effective. While this may be

true for blockage of large particles and splatter, dentists

also must protect themselves from aerosols that are gen-

erated during dental procedures and remain airborne

following patient treatment.©11

In clinical studies characterizing aerosols by particle

size, Pollok et al. showed that about half of such particles

were 3 um or smaller.* Aerosol particles of this size have

been shown to be particularly critical. In studies of 26

nonsmokers, Chan et al. demonstrated that particles

about 3um in size have maximum deposition in the

alveoli.12 According to Day et al., this deep penetration

App. 42

into the respiratory tract increases the infectivity of

microorganisms.'? Hence, face masks for dental use

should block particles down to at least 3 um in size.

Studies of toxicological warfare have confirmed that

airborne organisms can cause infections in man.'*!5 To

determine whether tooth-cutting procedures could lead

to aerosols containing oral pathogens in numbers suffi-

cient to infect humans, Belting et al. cut cavity prepara-

tions on tuberculosis patients with positive sputum and

cultured air samples following treatment.* They showed

conclusively that oral tuberculosis organisms become air-

borne in numbers sufficient to infect clinicians. At pre-

sent, the use of high-filtration facial barriers with close

peripheral fit is the best known way to minimize inhala-

tion and infections from this type of airborne bacteria.

Clinicians need to know the differences among the

various brands of facial barriers on the market. This

study compares the efficacy of various face masks and

shields in blocking airborne debris.

Materials and methods

The test protocol specified four evaluations:

(1) Three samples of all face masks studied

were tested in vitro.

(2) Selected face masks worn by clinicians

were tested to determine clinical effectiveness.

(3) Selected face masks were worn in high

humidity, then tested to determine the high

humidity’s effect.

App. 43

(4) Finally, a dye tracer test was performed on

selected face masks and shields to determine

importance of peripheral fit.

Collection of masks and shields

Brand names of face masks sold to dental clinicians were

identified, and identical masks sold under different brand

names were eliminated. However, when confidentiality

agreements prohibited identification of manufacturers,

similar masks were tested, as clinicians at times have no

way to confirm manufacturers and often must identify

face masks by brand name only. Face shields were

selected on the basis of market popularity and amount of

facial coverage. The table lists brand names of 42 face

masks and 2 face shields evaluated.

Bacterial filtration efficiency testing

Evaluation of 42 brands of face masks - Three unused sam-

ples of each of 42 brands of face masks were coded and

sent for bacterial filtration efficiency (BFE) testing at a

commercial laboratory that routinely performs this stan-

dardized procedure developed by Nicholes (Fig.1).16 A

24-hour culture of Staphylococcus aureus clinical isolate,

strain Utah 15, at a concentration of approximately 104

colony forming units (cfu) per milliliter, was used in the

following manner:

(1) The culture suspension was nebulized (Chi-

cago nebulizer*) to create a cloud with a mean

particle size of 3.0 um.

(2) The cloud was drawn through the test

mask at a rate of 1 ft3/min. and onto a 6-stage

App. 44

sampler (Andersen samplert) where particles

were separated by size onto one of 6 Petri plates

containing soybean casein digest agar (Fig. 2a

and 2b).

(3) The plates were incubated at 37°C for 48

hours; colony forming units were counted and

probable hit values were computed according to

Andersen’s method.!”

To determine the consistency of delivery for the chal-

lenge aerosol, control values were established through

sampling without a filter. Acceptable limits for this aero-

sol density were between 1,700 and 2,700 cfu/ft.3 To

determine proper functioning of the test system, a refer-

ence filter with a known BFE was tested. Challenge aero-

sol sampling and reference material evaluation were

conducted for every 8 to 10 test samples.

The following formula was used to calculate filtra-

tion efficiency of all test masks:

Percent BFE = C - F x 100,

Cc

where C (control) represents the number of particles sam-

pled when no mask was used an F (filtered) represents

the number of bacterial particles that passed through the

test mask. Mean BFE percentages were computed for each

set of three identical masks. One-way analysis of variance

(AOV) and the Bonferroni multiple comparison pro-

cedure were used to determine differences in filtration

efficiency among brands of masks.

Evaluation of four face masks after clinical use — The

Aseptex mask,* Dental Surgical mask*, and Magic Arch*

App. 45

masks were tested. Two general dentists and their pri-

mary chairside assistant wore coded face masks during

patient treatment for one, two, three, and seven hours.

Test periods were assigned randomly and repeated about

eight times. No attempt was made to alter patient treat-

ment. After each test, the mask was removed without

contacting its surface, and BFE testing was performed.

Mean BFE percentages were computed for each interval.

One-way AOV and the Bonferroni multiple comparison

procedure (alpha = 0.05) were performed to determine

differences among intervals during which masks were

worn, and between brands of masks tested and persons

wearing the masks.

Performance of 6 face masks in humidity > 90 percent -

ADDS-Air-Flow laboratory mask,** ADDS-Vanced labo-

ratory mask**, Aseptex mask, Aseptex Plus mask, Duck-

bill surgical mask,+ and the Dental surgical mask* were

tested. Two subjects (a woman 54 kg and a man 100 kg)

wore each of the test masks for 30 minutes in a chamber

(42 inches x 24 inches x 24 inches). Their heads and

shoulders were positioned inside the chamber, 6 and 12

inches, respectively, from an air-slurry polisher (Prophy

Jet 304) operated on medium water and powder settings

with an air pressure of 80 psi. After 30 minutes, the

masks were removed without contacting their surfaces

and BFE testing was performed as described above. BFE

percentages were computed and plotted against mask

type.

Dye tracer testing - The Aseptex mask, Magic Arch

mask, Cover shield,** and Op-d-Op shield*** were tested.

A test also was performed using the Aseptex mask in

combination with the Op-d-op shield.

App. 46

A subject’s head and shoulders were positioned

inside a chamber (30 inches x 30 inches x 36 inches) with

a nebulizer (Micro Mist Aerosolizer #P220*'t') emitting a

dye (Blue Crayola Tempera##+) diluted with three parts

Crayola Temperat#+ deionized water. Mean particle size

of the airborne dye was 4.8 um. The distance between the

facial barrier and orifice of the nebulizer was 6 inches

(Fig. 3).

Figures 4a to 4i illustrate the steps in the test pro-

cedures. A 2 inch x 2 inch cotton-filled gauze sponge

(Healthco No. HCOC535051"") opened at its center was

positioned so the nose was covered (Fig. 4g). Imperme-

able plastic was placed such that, for each facial barrier

tested, inhaled air was allowed to enter:

(1) through the mask and peripheral border

(Fig. 4c);

(2) through the mask material only (Fig. 4g);

and

(3) through the peripheral border only (Fig.

4h). Figure 4i shows the results of a positive

control test in which no facial barrier was worn.

All tests were conducted for 10 minutes.

The gauze nose wraps from all but the combination

Aseptex Mask/Op-d-op Shield tested were ranked

according to area and intensity of dye stain by 21 evalua-

tors who were not associated with the study. Kendall's

coefficient of concordance was computed to determine

agreement between evaluators.

passat:

> Fee ee

App. 47

Results

Bacterial filtration efficiency testing ~ In Figure 5, the

42 face masks tested are ranked in order of highest to

lowest mean BFE scores. Lines connecting brand names

indicate statistically non-significant scores, and overlap-

ping lines indicate statistically similar groups. The test

masks separated into two non-overlapping significance

groups. The high filtration group included 22 face masks

with mean BFE scores of 74 to 98 percent. All but two

masks in this group were soft, pleated, rectangular

masks. Two rigid, preformed, cup-style masks with a

unique design (the ADDS-Air Flow laboratory and

ADDS-Vanced laboratory masks) had filtration values of

91 to 92 percent. The scores of the 20 remaining masks

were significantly lower (13 to 51 percent). In fact, all

brands of conventional, cup-style face masks, including

the Aseptex and Aseptex Plus brands, were in the low

filtration group.

Figure 6 shows mean BFE percentages for 4 face

masks worn during clinical treatment. The two soft,

pleated, rectangular masks (Dental Surgical and Magic

Arch) had efficiency scores of 97 to 99 percent, regardless

of length of time worn. The Aseptex Plus proved to be

Statistically more efficient than the Aseptex. No statistical

differences were observed with respect to persons wear-

ing the mask.

Figure 7 shows the mean BFE percentages for 6 face

masks tested under normal (about 50 percent humidity)

and humid conditions (> 90 percent humidity); compari-

son of BFE percentages shows mask filtration was not

App. 48

affected adversely by high humidity. The size and gender

of the subject also had no effect on BFE scores.

Dye tracer testing — Figure 8 shows the gauze sponges

worn over the test subject’s nostrils during 10-minute dye

tracer tests. Kendall's coefficient of concordance (0.993)

showed high agreement between the 21 evaluators who

ranked the sponges. In Figures 8a to 8i, the gauze

sponges are shown as ranked, from least to most effec-

tive, by the evaluators. Results indicate the following:

(1) All test barriers blocked some airborne dye

and proved more effective than no barrier (com-

pare control gauze in Fig. 8a with all others).

(2) The face shields were least effective in

blocking airborne dye (compare Fig. 8b and 8c

with all others).

(3) The high-filtration mask provided the best

defense against penetration (compare Fig. 8g,

8h, and 8i with all others).

(4) High-filtration material and close periph-

eral fit were needed for optimum blockage of

aerosols (compare Fig. 8i with all others).

Figures 9a and 9b show leakage of dye tracer onto

the interior surface of a high-filtration mask after 10 and

30 minutes of use. This problem was evident to varying

degrees in all test masks. The colored dye enabled us to

observe a problem not clinically apparent, because most

dental aerosols (such as saliva and water) are colorless.

Mask penetration is highly significant because it can

bring airborne organisms into contact with the wearer’s

lips, nostrils, and skin.

Oh Bias inc nt ects cited

Nee IP tee ey ay ae g

App. 49

In an additional test in which the Aseptex mask was

used in combination with an Op-d-op Shield, aerosol

penetration was diminished only slightly (Fig. 10). The

combination did not provide the level of protection

offered by the high-filtration face mask (Fig. 8g to 8i).

Discussion

Several theories concerning face masks were dis-

proven in this series of tests. For example, filtration effi-

ciency was not decreased by use in a humid environment

for up to 30 minutes or by clinical use up to 7 continuous

hours. Filtration efficiency was not affected by gender or

size of the clinician. In addition, this study showed

clearly that the test masks were not equally effective in

preventing penetration of airborne debris. Shields proved

to be substantially inferior to masks, owing to their lack

of peripheral fit, which was shown to be as important as

filtration efficiency in blocking airborne debris.

Size of airborne particles is important regarding the

effectiveness of face masks. Investigators have demon-

strated that dental procedures generate large quantities of

aerosols 3 um and smaller.* Such particles remain sus-

pended at the end of treatment,®7 and can penetrate to

the alveoli of the lower respiratory tract,!2 where their

infectivity is greatly increased.!3 Therefore, dentists and

staff should use facial barriers that block particles of this

size, but our results showed only about half the test

masks met this criterion. Conventional, preformed, cup-

style face masks had low filtration. When choosing

masks, dentists must consider the fact that 50 percent or

more of deleterious airborne particles can filter through

App. 50

this type of mask. After reviewing these data, two face

mask manufacturers redesigned their preformed, cup-

style face masks to achieve high BFE ratings (Triple Layer

by 3M and Surgical Comfort by Healthco). These masks

are now available.

It is clinically relevant to establish the length of time

a face mask can be worn. This investigation showed

neither high humidity nor use over time affected signifi-

cantly the filtration of the masks tested. Dye tracer tests

indicated the critical factor is soak-through of airborne

debris. This process, called wicking, poses a threat when

the wearer’s lips and nostrils come in contact with moist

areas, thus establishing direct mucous membrane contact

with organism-laden material. Current mask design does

not allow clinicians to determine when wicking has

occurred, because interior surfaces of masks are not

stained visibly when wet by colorless fluids. Given pre-

sent mask technology, we agree with Craig et al., who

suggested mask changes after 20 minutes in aerosol and

60 minutes in nonaerosol environments.'® These recom-

mendations were based on culturing of masks worn clini-

cally. When worn longer than the recommended times,

the masks became impregnated with microorganisms

and, thus, were a source of, rather than a barrier to,

potential pathogens.

When gathering information on filtration efficiency

of face masks, dentists need to know that efficiency rat-

ings can be generated by two tests. One is the BFE pro-

cedure performed here; the procedure is well suited to

dental use of face masks. The other is the Greene and

Vesley test,!? which measures filtration from the inside of

the mask outward through use of large particles. This test

App. 51

is relevant to surgeons whose primary concern is deposi-

tion of droplets from the operator onto the patient. Unfor-

tunately, Greene and Vesley test percentages often are

used to promote masks to dental personnel because such

ratings are substantially higher due to use of larger-sized

test particles.

Filtration efficiency ratings of preformed cup-style

masks increased slightly after three hours of clinical use.

This phenomenon is common in BFE testing of cup-style

masks, and is thought to be caused by impingement of

droplets onto the mask. Some pores are blocked, which

temporarily increases filtration efficiency. Droplets then

coalesce, reducing filtration efficiency.

Confidentiality agreements between manufacturers

and distributors often result in very nearly the same

product being sold in different packaging. In this study,

testing of some similar masks was performed because, in

some cases, positive identification of manufacturers could

not be obtained. Testing was justified on the premise that

data was needed for specific brand names for which

manufacturers could not be identified positively. How-

ever, test results indicate similarity of manufacturing

technology, rather than the manufacturer, was the key

factor in mask filtration efficiency. Test masks were sepa-

rated by BFE ratings into two distinct groups, although

masks from more than two manufacturers were evalu-

ated. With only a few expectations, the 42 masks were

divided into a soft, pleated, rectangular, high-filtration

group; and a rigid, preformed, cup-style, low-filtration

group.

App. 52

Conclusions

Bacterial filtration efficiency ratings here indicate 22

of the 42 brands of test masks ensure efficient blockage of

airborne debris. Protective barriers against small-particle

aerosols should be selected from among this group (Fig.

5). Preformed, cup-style face mask with a conventionai

design, and face shields all provided significantly less

blockage of airborne particles.

The main factor in deciding when to discard a face

mask of nay kind was degree of wicking. Because pene-

tration of fluids such as water and saliva cannot be

observed on the mask’s interior surface, the recommen-

dations of Craig et al. (to change masks after 20 minutes

in aerosol and 60 minutes in nonaerosol environments)

should be followed.'§ They showed that masks worn for

longer periods became a source of infectious material.8

Dr. Christensen is director, Clinical Research Associates,

Provo, Utah, where Dr. Robison is coordinator; Ms. Robinson

is microbiologist; and Mr. Ploeger is virologist, Microbiology

Section. Dr. Leavitt is an associate professor of microbiology,

Brigham Young University, Provo, Utah.

Address correspondence to: Dr. Rella P. Christensen, Clin-

ical Research Associates, 3707 North Canyon Road, Suite 6,

Provo, UT 84604.

Acknowledgments

The authors thank Nelson Laboratories, Salt Lake City, for

performing bacterial filtration efficiency tests; Dr. H. Gill

Hilton and Dr. Howard B. Christensen, Center for Statistical

App. 53

Research, Brigham Young University, for statistical consulta-

tion; and Mrs. Judy Davis for manuscript preparation.

“Dependable Scientific Glass Co., Salt Lake City, UT 84115.

tAndersen 2000 Inc., Peachtree City, GA 30269.

43M Co., Dental Products Division, St. Paul, MN 55144.

#Alpha Pro Tech, Inc., North Salt Lake City, UT 84054

““American Diversified Dental Systems, Anaheim, CA 92806.

ttBaxter, Deerfield, IL 60015.

¢{Dentsply, York, PA 17405.

##GRD Products, Grand Junction, CO 81501.

““Op-d-Op Inc., Roseville, CA 95678.

tttMicro Mist Corp., Hudson, OH 44236.

¢t¢£Binney and Smith Inc., Easton, PA 18044.

###Healthco Inc., Boston, MA 02116.

References

1. Verrusio, A.C., et al. The dentist and infectious dis-

eases: A national survey of attitudes and behavior JADA

118:553-562, 1989.

2. Council on Dental Materials, Instruments, and

Equipment; council on Dental Practice; Council on Dental

Therapeutics (of the American Dental Association). Infection

control recommendations for the dental office and the dental

laboratory. JADA 116:241-248, 1988.

3. Centers for Disease Control. Recommended infection-

control practices for dentistry. MMWR 35:237-242, 1986.

App. 54

4. Joint Advisory Notice: Protection against occupa-

tional exposure to hepatitis B virus (HBV) and human immu-

nodeficiency virus (HIV). Fed Reg 52:41818-41824, 1987.

5. Occupational Safety and Health Administration.

Occupational exposure to bloodborne pathogens; Proposed rule

and notice of hearing. Fed Reg 54:23042-23139, May 30, 1989.

6. Pollok, N.L. III; Shay, D.E.; and Williams, G.H. III.

Evaluation of airborne contamination in a dental school clinic.

J Baltimore Coll Dent Surg 27:4-20, 1972.

7. Larato, D.C., et al. Effect of a dental air turbine drill

on the bacterial counts in air. | Prosthet Dent 16:758-765,

1966.

8. Belting, C.M.; Haberfelde, G.C.; and Juhl, L.K. Spread

of organisms from dental air rotr. JADA 68:34-37, 1964.

9. Travaglini, E.A.; Larato, D.C.; and Martin, A. Dis-

semination of organism-bearing droplets by high-speed dental

drills. J] Prosthet Dent 16:132-139, 1966.

10. Micik, R.E., et al. Studies on dental aerobiology: I.

Bacterial aerosols generated during dental procedures. ] Dent

Res 48:49-55, 1969.

11. Holbrook, W.P., et al. Bacteriological investigation of

the aerosol from ultrasonic scalers. Br Dent J] 144:245-247,

1978.

12. Chan, T.L., and Lippmann, M. Experimental mea-

surements and emptrical modelling of the regional deposition of

inhaled particles in humans. Am Ind Hyg Assoc ] 41:379-409,

1980.

13. Day, W.C., and Berendt, R.F. Experimental

tularemia in Macaca mulatta: Relationship of aerosol particle

App. 55

size to the infectivity of airborne Pasteurella tularensis. Infect

Immun 5:77-82, 1972.

14. Morton, J.D. Ability of present sampling devices to

determine the particle size distribution of biological aerosols

sufficiently accurate to predict the dose response in experimen-

tal animals. Eleventh Tripartite Conference on Toxicological

Warfare. Frederick, Maryland, Army Chemical Center, October

28, 1956.

15. Compton, J.A.F. Military Chemical and Biological

Agents: Chemical and Toxicological Properties. Caldwell, New

Jersey, The Telford Press, 1987, pp. 354-407.

16. Nicholes, P.S. Comparative evaluation of a new sur-

gical mask medium. Surg Gynecol Obstet 118:579-583, 1964.

17. Anderson, A.A. New sampler for the collection, siz-

ing, and enumeration of viable airborne particles. J] Bacteriol

76:471-484, 1958.

18. Craig, D.C., and Quale, A.A. The efficacy of face-

masks. Br Dent ] 158:87-90, 1985.

19. Greene, V.W., and Vesley, D. Method for evaluating

effectiveness of surgical masks. ] Bacteriol 83:663-667, 1962.

JOSIA peay onseid 0) poyoeye onsejd ‘pidu “meajp

SINOJUOS [eIDe] puv surey

Sasse]3 onseyd yy 0} poprour ‘onseyd ‘pidu ‘1eay>

$2 p ‘ojsue}901 poyeayd Syos

San p ‘o[Bue}D01 payeayd Syos

S31} p ‘o[sue}s01 payeayd “yos

Sal} p ‘a[sue}I01 payeatd ‘yo

dens onseys | ‘dno pouuojaid ‘prany

sdoo] e9 onseje Z ‘o[3ue}901 payeayd ‘yos

sdoo] 12 onseye Z ‘a]SuB}9a1 payeajd ‘yos

S23) p ‘a[suR}901 poyeayd yor

Son p ‘poyseyje JuusA09 aA

onseld seajo TM a[Buejo01 poyeayd “yo

sdooj Je oNseyle Z ‘o[3ue}0I poyeajd ‘yor

sdooj Je9 oNseI> 7 ‘a]BuejD01 poyeayd ‘yo

dens oyseje | ‘dno pouuojaid ‘pr3ny

dens onseje | ‘dno pouuojaid ‘prary

sdoo] Jed se at0s

Sa[OY JayoureIp yout ¢'Z “dis ureoy onse]g

sdooj Jed oNse]> Z ‘a]Sue}o0I poyeajd ‘yor

SON p “ofduejo01 poyeayd 4yos

dens onseye | ‘dno pouuojaid ‘pi3ry

dens onseje | ‘dno pouuoyjaid ‘pidny

dens onseje | ‘dno pouuojaid ‘pi8ny

dens onseje | ‘a[8uejoor poyeayd “yoo

Ssdoo] Jed INseIP 7 ‘aj3ue}D01 poyeatd ‘yo

S31} p ‘ajduejoo1 poyeayd “yos

SN} p ‘a[duej}Oa1 poyeayd “yoo

sdoo] Jeo onseye 7 ‘o]Suejoo1 payeayd ‘yo

dens onse[s | ‘a[8uejs01 payeajd ‘yo

asou JOA0 dens onseje | ‘Wosut dno pouuiojaid ‘pry

dens onseye | ‘dno pouuojasd ‘piary

Son p “opdueyos []Iqyonp ‘Yyos

dens onseje | ‘dno pouuojaid ‘pidny

dens onseja | ‘9[8uejs01 payeayd “yo

sdoo] Jeo onseye Z ‘a]Bue}901 payeayd ‘yo

dens onseyo | ‘o[3uej901 payeayd “yoo

Peal} ONse[e | ‘a[sue}01 poyeayd “yos

dens onseje | ‘dno pouuojaid ‘prany

dens onseye | ‘dno pouuoyaid ‘pi3ry

SON p ‘a]Fuee1 payeatd “yos

dens onseye | ‘dno pouuojaid ‘pr8ry

dens onseje | ‘dno pouuojaid ‘piary

dens onseje | ‘dno pouojaid ‘pidry

sdens onseje 7 ‘dno pouuiojaid ‘prary

sdeqs onseye 7 ‘dno pouuojaid ‘pr8ny

dens onsejs | “dno pouuosaid ‘pi8ny

App. 56

uondidseg

oouneaH{

Uead] “Y UH

4J9{XB Gy

We

uosuyor wz UosuYyos

uosuyor UOsUYos

oouneoH

oounfeaH{

SUIaISAG Ajayesorg

ueUeog 3 WOoIpUy

Toe

1em09

aournTy

aourllTy

[POD

[ewac] jay

[eyuoq jay

UB JUNOosI(] [euotssajoi1g

UB iuNoosic] [euorssajoig

UIaY9g

[eyuoc] jsy

Teiwaq eydiy

Jayxeg

Jayxeg

Jayxeg

oouneay

jeiwaq eydry

jonorg

SUIsISAg Ajayesorg

Jayxeg

jonorg

feuag eydiy

oouNeaH{

yseul ews eydry

UONII}01g IOLUE

Ajog purjs]

Jayxeg

Jayxeg

We

We

S\sTusY UBIINS

SUIDISAG [BIUAC] POYlssaic] UBOUOUTY

SUIDISAS [BIUSC] PoYtsJaAIG] uRSUSUTY

[Pajop

Auedwio,y

f \

pyerys do-p-dg 7

PJetys JoaoD |

(spjays 290.1)

eu-ni) “Zp

SISl# Ysew eoidms uo-aty [Pp

yseul Zoynue J] suiding “op

yseul [J ouldmg “6¢

yseul feoidmg “g¢

yseul Zoyyue peorsmg “1 ¢

yseu dooj-me ‘Yyos ‘o¢

YSBUI JOUSISOp BUIBIG “C¢

YSU! VUUIPPaYS “pe

yseut dooj-iwa payeajd-pjaryg “¢¢

YSU BY PJOTYS-ooj}01g “ZF

YSEUI PJPTYS-901g “[¢

pend pmy yim yseur dno pouuojoig ‘o¢

ySeul Ie YAJOY “67

Sdooj 189 YIM Ysvus yy WLIO] poywo[q “gz

SVU PIyB3[q “LZ

YSBUI [BOIS INS Popjoyy “97

YSeul JejNda1 popjoyy “SZ

JSCUI PIploW “¥Z

Yseul yore dIBePy “¢7

yseul UOHLIOSI UOHeNIY-Ysty] “ZZ

YsBul [BOIS IMs 20-304 °[Z

seul feoisms pjorys pmjy “Oz

yseul feoisms pend pny y “6 |

YSBUI JOM YOo]D0v. “g]

Hasut ajqesodsip tyim surey Yseus s0e4 |

yseul Joyesidsas w? isnq] 9]

yseul peors.ms [piqyong *¢|

yseus anjq aqesodsiq] *p|

ySeU [BOIS [RUA] “¢|

yseul sinpsooid jeywaq “Z|

yseul ampooosd peyuaq] “| |

yseur dag-q 0]

SPU [BOIPSU MOWUOD 6

YSBUI [BOIZINS SIss¥{> su0>

SPU [BOIS S1sse] >

yseul sniq xaidasy

ysew xaidosy

ySeUl Ht {-WOD [py-idasy

yseus AloyeJoge] poour A -Sqqy

seul AioyeJoge] MOL] INY-SGdV

seul sjorued Itx0] -UON NOSE “|

(sysmu 220.4)

aweu pueig

NANmrnwor oo

SPpatys ad" 2 PUL SHSBUI 99Ej Zp JO QUIeU puBAQ Aq IsY [eINAqGeYdTy “| afquy

ieee

App. 57

REFERENCE NO. 6

VOLUME 19, ISSUE 9 - SEPTEMBER 1995

CRA Newsletter

SUBJECT: OPERATING GLOVES, IMPORTANT NEW

TRENDS

Never before have so many dental clinicians used oper-

ating gloves routinely. Extensive use has revealed sensi-

tivities not anticipated. Glove manufacturers are now

seeking alternatives because glove sensitivity can force

clinicians to cease practice. This report on new powder

free alternatives focuses on: (1) Quality, clinical charac-

teristics, & cost of 32 brands of powder free gloves; & (2)

Clinical & lab data that strongly implicate glove defects

in virus transfer.

METHODS:

A. GLOVE ACQUISITION - 6 boxes of about

100 gloves each from 32 powder free glove

brands were acquired from 20 sources in 12

U.S. states from January through March ‘95.

B. CLINICAL CHARACTERISTICS TEST — 300

each of the 32 glove brands (9600 total)

were used during routine clinical treatment

by dentists & auxiliaries at 29 clinical sites

in 19 U.S. states & rated according to: (1)

Fit, (2) Tactile sensitivity, (3) Taste, (4) Tacki-

ness when wet, (5) Resistance to tearing, &

(6) Cuff length (adequate to pull over long

sleeve).

C. MANUFACTURING DEFECTS TESTS -

About 290 each of the 32 glove brands (9280

total) were tested in-vitro for perforations

(FDA Water Leak Test) & 9 of each brand

(288 total) were tested for time before

hydration occurred (Dental-Alert Monitor

by Novatec [713] 266-1976).

App. 58

LSAG=L ‘L-1 Jo 2J"Is UG ,

uopurpAy ayerpoumuy smopye a snosod sy Aur, b

“saaoys FAUTA - $}22JIP JCUPULLS|p JOU SIOP 489] YB] 19984, VA §

Bra | ot aay Saas CEICSFITEST Say TIpMOy AMA Pussy

36 tt b unr : UIX-TWCS)E@e Paty Tapmog uy, ajeseing |

46 ve b ug = UIX-T WS) ddAWd 2944 J9pmog FAUTA Id |

79 SP aa Z sor CEASYSZMD 93iy Dpmog sisipieg |

FL 6? apt ZT %sor - ei P

76 rr air Z Tis UIX-TICS SX tOSd aay Jopmog sayy Wiexy

76 oF ipl G TPs UTWS-SXY 10C-91 Saag Jopmog ALioquel)

78 SF apa ¢ %tP VIX’ TW-S-SX)-80tdd 9949 Jopmog esply |

8 Ts une Z Ye TT W-S-SX0# Spi OU) aij Japmog qeeg |

36 SF ut 77 TRS UPWCS) Lidst Saiy epaog painjxs |,

ait SF ~ eae 7T Ys TW-S-SXP 112-91 334g Topmog x9} 7d

7Ti SP “Gilt ¢T At VIX" TWS)t0-0te- Ol “ad Srey |

79 SF “aa TT %Lo UIX-TA-S-SX)-000c 90 Japmog suiyg |

36 SF “apa OZ Ye CTA-S)07T 9329 Topmog preny ar]

701 ts Up GT Yr C(TA-S-SX)-ddd 3805 PD Wei -O1g |

Era’ oF “apa TZ %Lt

Ta SP aa SZ re UIX-TW-S-SX)-tds Sa HEE

701 6F Wal OF Wis UTW-S)0007 Saay Tapmog seqpayy |

aii oF afar FZ Yet UT W-S-SX)-OF7 Fay Fpmol HM SS

For tY aya SZ Toe UTW-S)OS¢-70) Said 931] Tapmog won |

46 oF “Ul OZ aa | TTWCSHF Bpid 00) sary Tapmog suydyy |

IL rr “ahr OF RP TICS) 8la8 Were eommULEyY

701 OF “ERT OF RIF CTA-S)00T 998g Sopmog Wiexg Pesipsyy rae] |

39 Ts apa OF TP UTW-S-SXF pid 00) “pps feo

Fit oF “Wf 97 ad UTWS-SXS6-0F P21] Japmog Gono peng) |

76 sF Witt ZZ wri ; T

36 ws “aya ZZ wr UP W-S)E10t-D “GH plotting xapoisyy |

7a TF “UT OF se CIWS OPTS72O OI UPL) HL Uepeyy |

8 Ts ia OF ard UPW-SHGF pid 00) SA0fF) Wapjposy |

Fit oF ap OE Yt CTVCS) $11 Wiiojue> Tpsry

701 LY apa EZ Ror (TAS) O TIL) Spepmog rajssor ) |

INO) 729 flit BZ FLO TIOULOD) (6 C/1s)001 G-Paorg |

oe im ~ SAL

oy cs

SHAOTD AqaA AAAGMOd 7 AO LSOD

¥ ‘SOLLSRIALOVUVHD TVOINITD ‘(2mn uoNnespdAy 2 $393j2P) ALVYTWAO AAOTID ‘I

App. 59

BEST GLOVES OVERALL ARE Biogel-D, Crosstex

Powderless, Ansell Conform, Golden Glove & Aladan

Tri-Clean 110. LEAST EXPENSIVE, BEST OVERALL

GLOVE is Golden Glove.

2. CLINICAL & LAB DATA THAT STRONGLY IMPLI-

CATE GLOVE DEFECTS IN VIRUS TRANSFER.

PREMISE: Gloves are worn by clinicians to prevent expo-

sure of patient & clinician to each other. Integrity of the

barrier is first concern.

IN VIVO LEAKS DEMONSTRATED: A Los

Angeles surgeon who infected 18 of 142 patients

(13%) in 10 months with hepatitis B theorized

that finger irritation & pressure from suture

tying might be implicated in virus transmission.

Tests showed hepatitis B virus in washings from

inside of gloves he wore while tying sutures,

indicating he shed virus through skin on his

fingertips. These viruses (42 nm), shed through

irritated skin & escaping through defects in

glove fingers provide first plausible explanation

of disease transfer between patients & a clini-

cian practicing Universal Precautions. (New

York Times, March 22, 1994, C3)

IN VITRO LEAKS DEMONSTRATED: Investiga-

tors testing 240 latex & 240 vinyl exam gloves

found leakage of test virus $X174 in both types

of gloves, regardless of whether gloves were just

removed from box or stressed in 3 levels of

simulated use. At heaviest use level, vinyl

gloves leaked virus 9 times more frequently

than latex gloves tested. (Korniewicz, D.M. et

al., J Clin Micro 1990; 28:787-788)

**WITHOUT EFFICACIOUS INFECTION

CONTROL PRODUCTS, THERE IS NO CON-

TROL OF INFECTIOUS DISEASES.

App. 60

CAUTIONS: A. Chlorination treatment is most common

ES way to make powder free gloves. Pro-

cess is conceptually good because it

lowers protein antigens. In practice it is

often done poorly to save time & money,

& results in shortened shelf life,

increased defects, slippery surface, foul

taste & smell on gloves, brittle & crack-

ing fingernails on clinician.

B. Vinyl is porous.

**CHOOSE POWDER FREE GLOVES CARE-

FULLY. STORE COOL, & USE WITHIN 3-4

MONTHS.

3. CRA CONCLUSIONS:

Dental clinicians need to be aware that routine use of

operating gloves can result in various hypersensitivity

symptoms. Prevention is superior to searching for solu-

tions after symptoms develop. New option is powder

free gloves. Outstanding gloves in evaluation are listed

above under BEST GLOVES.

App. 61

REFERENCE NO. 7

VOLUME 16, ISSUE 10 - OCTOBER 1992

CRA Newsletter

SUBJECT: GLOVES, NON-STERILE OPERATING -

UPDATE REVIEW

One year ago, CRA reported on quality & cost of 6,000

non-sterile operating gloves representing 20 brands used

by dental clinicians (see Sep. ‘91 CRA Newsletter). Only 4

of 20 brands tested had combination of reasonable cost,

overall good clinical characteristics, & low defects (7 of 20

brands met FDA’s specification of 4.0% or less defects).

Since both clinicians & patients depend on operating

glove quality as primary infection control barrier, 1 year

later the same tests were performed on all gloves still

available to check for improvements. Following report is

written in style similar to ‘91 report to facilitate compari-

sons.

1. TEST METHODS.

(a) GLOVE PURCHASE - Three boxes contain-

ing 100 gloves each of 24 brands of operat-

ing gloves were purchased from 36

distributors in 12 states in April, May, June

‘92. These included brands from the ‘91

evaluation, several new brands, & gloves

from 1 manufacturer sold by 3 different

distributors.

(b) CLINICAL CHARACTERISTICS TESTING

- Seven characteristics evaluated were: (1)

taste, (2) powder amount & texture, (3)

tackiness after wetting, (4) tactile sensi-

tivity, (5) resistance to tearing, (6) fit, & (7)

cuff length & width.

(c)

App. 62

MANUFACTURING DEFECTS TESTING -

FDA in vitro Water Tight Test was per-

formed on 7,006 gloves to identify manu-

facturing defects. (All 7,200 gloves

expected in this test were not available for

testing due to presence of less than 100

gloves in 24 of the 72 boxes. One box con-

tained only 54 of expected 100 gloves!)

2. RESULTS.

Refer to chart on page 2 for brand names that

correspond to number abbreviations below &

for details of evaluation.

(a)

Gloves with best combination of reason-

able cost, good clinical characteristics, &

low manufacturing defects (pinholes) were

defined as having cost of 8 cents or less,

overall “good” clinical rating, & 4% or less

defects. By these criteria #’s 1, 2, 3, 4, 5, 6,

7, 8, 10, 11, 13, & 17 were noteworthy.

Gloves with best combination of above

characteristics both in ‘92 & ‘91 were #’s 1

& 3.

Gloves with least manufacturing defects

(pinholes) were #’s 1, 4, 9, & 12.

Gloves with least cost (6 cents/glove) were

*s 1, 2, 3, 5, 35, ate Oe oe

Comparing ‘92 to ‘91 evaluation, following

was observed:

(1) Significantly fewer manufacturing

defects were observed (i.e. 2.5% or 176

total defective gloves out of 7,006

tested in ‘92 vs. 6.6% or 392 total defec-

tive gloves out of 5,937 tested in ‘91).

App. 63

(2) Clinicians desiring gloves with 4.0% or

less manufacturing defects (FDA maxi-

mum allowable) have more brands

from which to choose in ‘92 (i.e. 19 in

"oe Va. A 94).

(3) Clinicians desiring gloves with overall

best combination of reasonable cost,

good clinical characteristics, & least

manufacturing defects have more

brands from which to choose in ‘92 (i.e.

12 in ‘92 vs. 4 in ‘91).

(4) No gloves were rated excellent in all

clinical characteristics in ‘92 (i.e. 0 in

‘92 vs. 2 in ‘91).

3. OBSERVATIONS:

(a)

More boxes of gloves lacked the expected

100 gloves than noted in previous tests (24

of 72 boxes). Most problematic were glove

#’s 1, 10, 12, & 15.

Cuffs on about half of gloves tested were

too short to remain over fitted uniform

sleeve to provide continuous barrier from

hand onto arm.

Some glove designs have recognized need

for anatomically placed thumb on non-ster-

ile gloves to relieve pressure on hand

(glove #’s 17 & 21). Glove 23 was nitrile

rubber rather than latex, which conforms to

hand better & relieves pressure.

Many glove brands now make “hypo-

allergenic” claim. CRA questions whether

any glove made from latex can be truly

hypoallergenic. In future, FDA may set

App. 64

standards for gloves making this claim, but

currently no standards exist.

(e) Since manufacturing defects continue to be

a consideration, methods are needed for

clinicians to test gloves before use &/or

apply something to gloved hands to seal

surface.

4. CRA CONCLUSIONS:

Overall quality of non-sterile operating gloves tested

has improved substantially over last year. Twelve of 24

brands had combination of reasonable cost, good clini-

cal characteristics, & lowest manufacturing defects — a

30% improvement over ‘91 test results. One glove (S.S.

White Latex Dental Exam Gloves) had no manufacturing

defects in 300 gloves tested, which demonstrates holes

in gloves are not inevitable. CRA urges all glove manu-

facturers to strive for consistent zero defects & improve

clinical characteristics.

4

a -

oS

a

Bir

DS

>

mat

Bd

+

oR

&

a

x

hs

oe

Powis

en)

ie

4

e

App. 65

(aA0]8/P¢"L) LS88#

S9X0q 07% jo oseB) S9A0]S)

“PTZ pooy OOL/87'L$ XOB'] WBXF/JOO],J WeX9],J [RoseULIey “¢]

(aa0j8/9¢"L) LIOLOLIDOOH F LOOLOLDOOH#

S9X0Q OZ jo ose) SeA0CTH

%0'I / wey OO1/0S'L$ UoneUTUeXY xXoqe] a[qesodsiq] Ooupeop] “Z|

(2A0]8/99) PIW-LS-D'T#

SOX0G ol jo ose7) S9A0]L) UOTPBUILBX

%I'E poor OO1/S6'S$ Xaye’] oTuUadoyeodAPy yonoy AIS “[ |

(2078/51)

S9X0q ()] JO 9S¥D ZOOI#

%L'| poon OOL/0S L$ S2AO[H [BOIPSY Xoje’] UBpeTY ‘O]

(2a0]8/9g)

SIX0G Qj JO 9seD L00S6#

%0'0 ie J 001/00'8$ SOAO|F Wexy [BUI] Xe] NY S'S “6

(aa0]3/9¢°9)

S9X0G ()| JO BSED ZIOI#

“pT pooy OOL/SP'9$ S9AO[H UONBUTUIBXY XB] XOOAOTH_“g

(2078/96 '9)

S9X0q (| JO ase_ OSO8#

%0'7Z poor 001/06'9$ SOAO|H) UOTBUIWIEXY X9yB'] sIBDJoqqny *Z

(aa0j8/9¢°z) l#

S3X0q Ol jo oases) S9A0]S)

%E| poo OOL/0S ‘L$ Xj] s]qesodsiq] .NOA SeAo]H BIpNy,, “9

(20]8/99)

S9X0Q YZ JO 9s¥D £0001 LOOOI#

“PZ poor OOL/S6'S$ SdA0|H UoORBUTUIEXY o[qesodsiq] oulIg “¢

(2a0j8/9¢z)

S9X0q (| JO aseD ZOI-X T#

%0'| poo OOL/0S'L$ SdA0[H WexY poyyodsiq xoyumury = “p

(anoj8/99) JO}OD [RNeN#

S9X0g QZ JO asBD SSAO]H UORPUTUTEXT

%'TZ poon 001/00'9$ X9]B'] 9[U2}¢-UON TPH] OdV “Lx

(aA0]8/99)

SIXOQ (| JO 9sBD IZ7LINV#

%/"| poor OO1/S6'S$ S9AO[H Wexg Xaye] XUN “7

(2A0]8/99)

S9XOq 07 JO as¥_ Old#

%0'| poop OO1/S6'S$ S2AO[H UONBUTUEXG [BUI] XI J-O1g “| »

SLOadaq | S§ONILVY | LSOO TIVLAY TUAaWOAN UACUO F AWVN AAOTO

AAOTO TVOINITO Ga.Lsapons

TGALSAL SAAOTD 'S

“VuO Aq pajsa} asouj se sures 9q jou ABUT soAo]d asned0q po}st]

aso} UBY} Joy} SIO;NGLAsIp Woy Sutseyond ft peYO aaoge UO soaoj3 aseyoind 0) ZuNdwIaYe JI [NJare9 og ‘NOLLN¥KD

‘PSUTULIS}op UBSUT [[PIOAO UB w? (p=100g

‘E=He J “T=POOH *| =JU][90xq) Ajoyesedas popesd asm (q) | Wot “| o8ed uo poyst] SoNsUa}oRIeYO JworuN]O / Jo yor §

‘spojep BuULMjoORINUBU MOT WZ ‘SoNSLIa}ORIeYD

[BOTT] Pood []BIOAO “JSOd a] qeUOseaI Jo UONLUIQWIOD PRY JeY) SUONENIBAD 76, F 16, HOG WOY SdA0[3 sayeoIpuy

‘Oped jSoq = JOqUMU MO’] ‘soAoT3 jo

S9X0q € Ul Spajop BULMjORINUBU UeoUI ap ‘soNSUIA}OBIBYO [ROTUTID / “soo ssor0e BuIseIOAR JO [NSAI st BuNRI [[eIOAG

= oo (ea0[8/95"S 1)

oe Sax0g (| JO ase_ 90L86b- 18884

ea - %Y'p ie J OOL/0S'SI$ SOAO[H UeXy Xow] IqUIY XOyeHEN “PZ

Se (2a0[8/9¢ 1)

: S9X0q (7 JO ase_ Ws009#

MP'Z poop 001/00'S I$ S2A0[H X2Q-N [WIN “€Z

. (2a0[8/9¢°9)

= S9X0g (| JO ase5 7-Xa#

1 %8 poop O01/0S'9$ SOAO|) UORBUTUTEXY X9}B] JOOHOLY “77

oS (0n0]8/9Z1) S98-Ob#

: S9X0qg OQ] Jo sseD S9A0TDH

YE poop OOL/SE' IIS WEXy X9}B] WSTY/Yo'] Yonoj end “[Z

(2A0]8/92 01)

S9XOG (| JO 9S¥D IZLS B IPLs#

ME] ie J OOV/L9'O1$ S9AO[H [BOIPSY] Xaye'] YON] -O1IY ‘OZ

(2078/21) vpOOI-D'l ¥ £001-D T¥

SOX0qG 0Z jo ose*) S9AOTH) UOTNeUILe XxX]

= %Y"p pooy 001/S6'9$ Xo}e'] Otusd Ja]; y-odAH puajog “6 |

ie)

é: (aa0[8/99) ZOLO#

Qa, SOX0qQ Ol jo ase SSA0[H

< “py sey 001/66'S$ UoneUTUeXy X9}e"] POM BIQUNJOD ‘g]

(jsoo UeIpeues)

(aa0]8/9¢°6)

S9X0G OZ jo oSBy) # Japso ON

%L'I poor OOL/SP'6$ SPAO[H Wexy [BUI] Xoye"] WpeINeNY “|

(2A0]8/9¢"1) 007 ¥ O0E#

S3X0qQ Ol jo oSeB°) SPAO]L) UOTBUTTeX yy

%0'7Z ie, OOL/SP' L$ X9}B'] Usd JoyPeodAH] urysayeg 9]

(2A0]8/29)

S9XOg OZ JO aseD 1008 # 00084

%Tp poo OOL/S6'S$ S9AO[H UONPUTUIeXY Xo}e’] YUOMs}eYyD “S|

(2a0j8/9¢°9) [Z000IDOOH ¥ 1 10001IDOOH#

S9X0qQ OZ jo oSB*) S9AO0]S)

“pT me J 001/0S'9$ uoneUTUeXY xa}e’] o]qesodsiq] |[asuy ‘P|

App. 67

REFERENCE NO. 8

VOLUME 15, ISSUE 9 - SEPTEMBER 1991

CRA Newsletter

SUBJECT: GLOVES, NON-STERILE LATEX

Use of operating gloves by dental clinicians has become

standard practice in U.S. AIDS epidemic & recent govern-

ment regulations (OSHA) are factors responsible for shift

from bare hands to gloves. Today, question is not “Should

I wear gloves?” but “WHICH GLOVES should I wear?”.

Choices are based heavily on cost, but clinical characteris-

tics also influence decision. However, most important

factor — absence of holes - generally is not considered

because clinicians have no way to detect small defects

called pinholes, where molten latex failed to fuse during

manufacturing process. U.S. government (FDA) has set

4% as maximum pinhole defects allowable in non-sterile

latex gloves. Unfortunately, FDA tests that detect pin-

holes render gloves unsuitable for clinical use. To identify

glove brands with least pinholes, most desirable clinical

characteristics, & most reasonable cost, CRA purchased

6,000 gloves from all over U.S. & subjected them to test-

ing. Below report includes: (1) test methods; (2) results &

observations; (3) CRA recommendations on glove use; (4)

gloves tested (page 2 chart); & (5) CRA conclusions.

1. TEST METHODS.

To consider 3 areas of interest to clinicians con-

cerning gloves (cost, clinical characteristics,

defects [pinholes]), CRA:

(a) Surveyed 10,000 dental clinicians to deter-

mine most popular gloves & most common

sources for purchase (Dec. ‘90 CRA News-

letter).

(b)

(d)

App. 68

Purchased 6,000 gloves from 18 distributors

located in 13 U.S. states.

Tested clinical characteristics (taste, pow-

der amount & texture, tackiness after wet-

ting, tactile sensitivity, resistance to tearing,

& fit) in controlled in-house & field tests.

Performed in vitro test for manufacturing

defects prescribed by FDA (Water Tight

Test) on 20 different glove brands using 100

gloves from each of 3 different boxes. Every

attempt was made to secure 3 different lot

numbers. Lot distribution among brands

was: 11 with 3 different lots, 2 with 2 differ-

ent lots, & 6 with only 1 lot. Gloves were

tested in multiple replicates (1 replicate = 1

glove from each of 60 boxes in random

order).

2. RESULTS & OBSERVATIONS.

Chart on page 2 gives details of evaluation.

Below is summary of results:

(a)

(b)

(c)

Gloves with combination of low pinhole

defects, most of desirable clinical charac-

teristics, & reasonable cost were #’s 2, 3, 5,

6 on page 2 chart.

In pinhole defects, 8 of 20 glove brands

tested met FDA specifications of 4% or less.

They are listed as #’s 1-8 on page 2 chart.

In clinical characteristics, 3 of 20 glove

brands were rated excellent (#’s 1, 2, 5 on

page 2 chart), 12 were rated good (#’s 3, 6,

8, 9, 10, 11, 12, 15, 17, 18, 19, 20 on page 2

chart), & 5 were rated fair (#’s 4, 7, 13, 14,

16 on page 2 chart).

App. 69

(d) Left/Right Latex Exam Gloves sold by

Smart Practice had least defects, best qual-

ity across lots, & most novel design. This

was only glove in study constructed on

“clutched hand” mold rather than flat hand

mold. Purpose of this innovation is to

relieve continuous stress on hand muscles

when gloved fingers are in working posi-

tion on instruments.

(e) Nitrile N-Dex Gloves sold by Safeware

Supplies was only glove in study made of

nitrile rubber rather than latex. Although it

did not pass FDA specifications for maxi-

mum pinhole defects in new gloves with

8.3% defects, tests showed it was consid-

erably more resistant to puncture during

use.

3. CRA RECOMMENDATIONS ON GLOVE USE.

(a) Wash hands well before putting gloves on

& between glove uses to lower microbe

counts. Warm, moist environment created

by gloves accelerates microorganism activ-

ity on skin. Use antiseptic demonstrated

rapid antimicrobial activity plus residual &

cumulative action. CRA tests show 4%

chlorhexidine gluconate formulations meet

these criteria best. Some brand names

include Bactoshield, CHG, Excelle, Hibic-

lens, Luroscrub, Novoclens, & Steri-Stat.

(b) Wear long sleeved uniform & purchase

gloves with long enough cuff to allow glov-

ing over uniform sleeve. Purpose of gloves &

uniform is to provide barrier between envi-

ronment & bare skin. Bare arms compro-

mise this goal.

App. 70

(c) Today, patients want assurance operator’s

gloves are used only in their treatment.

Plan to glove & deglove in front of each

patient.

2

@

eG

(d) Operating gloves should not be used for :

operatory cleanup because design that

allows tactile sensitivity is not as resistant

to puncture as utility gloves.

‘pasinbas jou st siqy Apuains yng “Xoq Yora UO pays] aq P[NoYs JomoejNUBUL Jo Ssamppe IZ aUTeU ‘9oINOs SUUNJORINUEUL

0} Aypenb aaojd soy Ayryiqrsuodsas Yur] oO] °29R4) 0} SuBIOTUT]D Joy ajqissodun apesd 2 vosnos BuLMpoemNUeWL Paola sayeul

WY} YOMJoU UAAOALID {UT paywoijdutos sey ANSNpUl IA0]H “WYO Aq paisa) 2soy) sB aus dq jou ABUL S2Ao]3 asnesaq past]

soy) UY) JoUVO sJONgLYSIp Wo Surseyoind jr LEYS aaoge Uo saaojd aseyoind oj Bundwiaye jr [ryases ag “NOI F De

GOL JO Sex0q QZ Jo aseD

1O008#

SIAO[H UONBUTIEXT X91B7] ‘OZ

# J2PIQ ON

SOA0[D X2}e’] a[qesodsiqy

6l

WOX#

SIAO]H UOLRUTUIEX|

X9JB'] D]LIDIS-UON a]qesodsiqy] ‘g]

LOOT a#

SOAO[H UOIBUTUIEXY X9]e']

Li

ZOOL-W#

S9A0[H UOTRUTUeXy X9}e7] “9

SOOL#

SPA0[D X9C-N FUN “ST

# Jopso ON

S9AO[H UONBUTUIEXT X28] Pp]

7OIS#

S2A0[H UONBUTUTeXs s[qesodsiq] “¢]

TOOL#

SOAO[H [BIIPIy X28] “Z|

LOOLOLDOOH#

SZISTU) SRONXSpIquiYy

—S2A0[H UONBuTUTeXy X9}e'] a]qQesodsic]

Il

OLOL#

SIAC] UOTBUTUTEXY Xa}e] PITRE

snoyxepiqury s[qesodsic] xa}2A0] ‘O|

LS88#

SPAO[H WexF/JOO]] WeXa]J feoseULIeYg 6

IL0001LD09DH ¥ [Z000LDODH#

S2A0[f) UONPUTUTRXG] Xa}e] a[qesodsiq] -g

bOOl-Ol#

S2A0]H UONeUTUBXY XaVe7] puajaq]*/

COL-O#F

SPA0[H 2 qQesodsiqy

snonxepiqury asodimg-nmyy xe] [Ty “9

OO-O7LS 40 [7LS#

S9AO0[D fea] JO

SIA0[H [BIIPEPy XB] YONO]-oIIpy*S

9OL86b- 18884

S2AO[H UeXy Xoqe’] |quIy XayeneN “p

App. 71

s OOO 1 a#

XI] J-Olg] Pe][Bd MOU SPAOCTH WRX] xB] ¢

MWOdV#

SPAO[H UOHRUTIEXY X9}e] IJUD}IS-UON 7

(PIOW PUeH] PeyrINID) OL8Or#

SOAO[H WeXY XI}e'] wsNyye] B

*dHeWNN YACUO F AWVN SAOTD

“palopIsuod SONSUIA}VIEYO

SIS] (9) Way ‘| UONIeS ‘| “BY gy ‘yusosod ajoyurd ysaq Jo Japsg GALSAL SHAO'lD *b

pen. Peel ey eee

App. 72

5. CRA CONCLUSIONS:

Gloves with combination of consistently low pinhole

defects, most of desirable clinical characteristics, & rea-

sonable cost are listed in chart above under following

numbers: 2, 3, 5, 6. Most gloves tested (12 of 20 brands)

exceeded 4% defects specified by FDA, indicating need

for clinical method to test for defects before using

gloves or material to spread over gloved hands to seal

latex surface before use. Currently double gloving is

only way to manage glove defect problem.

App. 73

REFERENCE NO. 9

VOLUME 13, ISSUE 1 —- JANUARY 1989

CRA Newsletter

SUBJECT: OPERATING GLOVES, UPDATE

STATUS OF DENTAL GLOVES IN U.S. Operating

gloves are now used routinely by many dental clinicians.

Primary factor in change from bare to gloved hands was

AIDS epidemic which stimulated increased awareness of

infectious diseases in general. Unexpected demand for

gloves created shortages, increased prices, & decreased

quality. However, currently supply is surpassing demand,

& cost & quality are improving. In future, government

regulations will stipulate criteria for both sterile & non-

sterile glove quality.

GLOVES SELECTED FOR CRA EVALUATION. Glove

origin must be identified by consumer to determine glove

differences. This is difficult because a few manufacturers

supply a large number of distributors. In order to conceal

fact that same glove is sold under many different brand

names for many different prices, name of glove manufac-

turer is generally kept confidential & each distributor

uses unique brand name &/or label designs. This practice

has serious implications for clinicians having hypersen-

sitivity & fit problems. It also prevents check to ascertain

if glove cost is commensurate with quality. To overcome

these communication obstacles, chart on page 2 lists

gloves tested alphabetically by manufacturer's name.

GOALS OF EVALUATION. CRA goal for this evaluation

was to test gloves sold by well known distributors that

represented all 6 major U.S. manufactures (Aladan,

Ansell, Baxter/Travenol, Perry, Surgikos, Tillotsen), plus

i

Ra i aan

— a NEN et PIL ATT EET iE EE BE REPO ELLE OE LEAP LILLE SOLID LE ALLIED LEED ELL eee

App. 74

manufacturers outside U.S. To locate your particular

gloves in chart on page 2, call distributor where you

purchased the gloves & obtain manufacturer's name.

Refusal to disclose name of manufacturer generally indi-

cates problems with quality or pricing.

CHARACTERISTICS TESTED & PROCEDURES USED.

Glove characteristics tested were: (1) Manufacturing

defects using 2 different methods (TEST METHOD 1 -

ASTM Airtight Test, ANSI/ASTM D 3577-78a. Glove

inflated with air [1.5kPa or ~ 0.657 psi] & submerged in

H,O so longest finger is about 200 mm from surface &

tester checks for escaping air. TEST METHOD 2 -

Ballbach Air Inflation Test, Ballbach R.L., et. al., J AOAC,

55(5)1074-1080, 1972. Uses protocol similar to ASTM Air-

tight Test except glove is compressed to force air into one

finger at a time which places glove material under ten-

sion while tester checks for escaping air); (2) Smell; (3)

Taste; (4) Amount of powder; (5) Tactile sense; & (6)

Resistance to tear. Test results are reported in chart on

page 2.

CRA OVERALL CONCLUSIONS:

Gloves with comparatively good quality were identified

in all 5 categories tested. This information provides

clinicians with tenable basis for glove selection. Clini-

cal characteristics such as smell, taste, amount of pow-

der, tactile sense, & tear resistance need improvement in

most gloves tested. Chart on page 2 links names of

manufacturers & distributors to specific gloves. This

assists clinicians with hypersensitivity & fit problems

to identify gloves with actual differences. Two brands

of vinyl gloves tested demonstrated quality that enables

individuals hypersensitive to latex gloves to consider

App. 75

them as viable alternative. One copolymer over-glove

had very low number of defects, making it possible to

consider over-glove as way to avoid contamination

when touching telephone, patient chart, x-rays, pencils,

or pens, etc., during patient treatment.

1

Ge ee

App. 76

EEE EEE ee

‘amssoid

Jamo] Jopun st sJoduy out passaiduios

Te 3 Xaje] Sv AONSeIa SUS Savy JOU s2Op

[@LIa}BUl ZAC] asnvd9q Mo] AJaANdaoap are

jS2] UONRYU] Iny yorqijeg 3uisn sa8ejusoied ‘POYISUl sTty UT posn

}OaJaq] ‘SPAo[3 asoy} JO] 39} prepueys sampaooid Suyunou popnioaid Ayoyseye Jo youy

UO payoRal UdAq JOU sey JUSUIBSIS 4 asnesaq Isa] YSTUTY WLSV Bursn pajsa}30N LN

Jood = ‘Tej=,J ‘poo =H ‘juapjaoxe =q ea ‘ysanbas uodn ajqeytear pajsaj so], \

beth 1@) peynuspuy) “¢

SOS OO

CONS

te

OIsIsA-AJog UMULTY |]

ie TIWALS-NON WANA T0d05

Se

JOUDABIT /J9IXVg = *]

ousARIL/JaxXeg |

Bisdepeyy peynuepuy) “¢]

poynuapius)

Seater:

TE eh Pee ee TUWIISNON XLV

elelelelelelelsel ss :

res] mA — os > ey A” ty od a

e ~ 2 ae O : mH 3 QO 4

Ww * _ wn - —< OQ

A a) tm oy

4|a|2 ee Z ae) ZS

m7 | © x 4 oa yA

o) 5

3 ae S18 | as z ‘2

feo) = >| awn 2

a) es

La ye m © i.

7 * =) c? “=z Z

es) on o

an * at ~” a ‘o) i

ro! . ce

a1 ig

7 oe

—

fe)

v2)

4 qd o S| V

SHAOTS ONILVUAdO AO NOILLVOIVAT

App. 77

TEST RESULTS BY GLOVE TYPE:

Ie

LATEX GLOVES - Most gloves tested met, or came

close to meeting, <2.5% manufacturing defects using

ASTM Airtight Test. However, if latex was stressed

(Ballbach Air Inflation Test), percent manufacturing

defects on all gloves tested increased significantly,

indicating presence of weak spots &/or smaller

holes not detected by ASTM procedure. Generally,

best gloves had low ASTM & Ballbach percentages,

& Ballbach percentages were only 3-4 times higher

than ASTM percentages (ie: gloves listed alphabet-

ically on chart above as Ansell, Baxter, London Rub-

ber, & Surgikos). Some imported gloves came close

to this criteria (Malaysia), but gloves tested from

Taiwan & China had substantially higher number of

defects. Clinical characteristics of all gloves tested

need improvement.

VINYL GLOVES - Brands of vinyl gloves tested had

Significantly fewer defects than those tested by

CRA in past using same method. However, test

method used could be questioned because standard

test for vinyl gloves is lacking. Baxter/Travenol &

Becton-Dickinson Tru-Touch gloves could be alter-

natives for clinicians hypersensitive to latex gloves.

COPOLYMER OVER-GLOVES - Quality of Armin

Poly-Version copolymer gloves was significantly

better than expected for this type manufacturing

process. These gloves could be useful worn over

operating gloves during non-treatment tasks

required during patient treatment such as handling

x-rays, patient chart, telephone, etc. Gloved hands

should be washed well before touching over-gloves

to minimize cross-contamination.

App. 78

REFERENCE NO. 10

Journal of Clinical Microbiology, Apr. 1990 p. 787-788

0095-1137/90/040787-02502.00/0 é

Copyright © 1990, American Society for Microbiology

Leakage of Virus through Used Vinyl and

Latex Examination Gloves

DENISE M. KORNIEWICZ!, BARBARA E. LAUGHON2,

W. HOWARD CYR:3, C. DAVID LYTLE’, AND

ELAINE LARSON!

School of Nursing! and Division of Infectious Diseases, School

of Medicine,* Johns Hopkins University, Baltimore, Maryland

21205, and Division of Life Sciences, Center for Devices and

Radiological Health, Food and Drug Administration,

Rockville, Maryland 208522

Received 29 August 1989/Accepted 19 December 1989

A total of 480 examination gloves (240 vinyl and 240

latex) were stressed by using manipulations designed to

mimic patient care. At the highest use level, 38 (63%) of

60 vinyl gloves leaked bacteriophage 9X174 compared

with 4 (7%) of 60 latex gloves. At lower use levels, there

was no Statistically significant difference in leakage.

Recently, there has been concern among health care

personnel about the use of vinyl and latex gloves as

barriers against the transmission of microorganisms. A

recent outbreak of herpes whitlow among intensive care

nurses who wore gloves’ has focused attention on the

integrity of gloves during use. We previously investi-

gated vinyl and latex examination gloves as barriers

against bacteria and found that both types of gloves

provided some protection, but latex gloves maintained

EN A Ae Ie Ne

Pe Te. 2 ee A Pat *f te eS

App. 79

integrity longer under in-use conditions.® Dalgleish and

Malkovsky? have reported that the quality of latex gloves

varies with the manufacturer and that latex gloves may

not give total protection from human immunodeficiency

virus penetration. In fact, gloves scanned by electron

microscopy have shown 30- to 50- um holes, suggesting

that viruses could penetrate the gloves.! Degroot-

Kosolcharoen and Jones® investigated the permeability to

water and blood of sterile latex gloves and examination

latex and vinyl gloves and found greater leakage in

examination gloves. Health care personnel continue to

question the barrier effectiveness of latex and vinyl exam-

ination gloves used in clinical practice. This study was

conducted to determine whether bacteriophage X174

could penetrate used vinyl and latex examination gloves

after standardized manipulations.

Procedure for glove manipulation. Because of find-

ings in our previous study (6), standardized manipula-

tions designed to mimic patient care activities were

performed on groups of gloves in advance of testing

(Table 1). Participants wore no rings or nail polish and

had their fingernails filed short and smooth. Sixty gloves

of each type were tested at each use level. As positive

controls, vinyl and latex gloves had either two or five

holes punctured in the index finger with a 21-gauge

hypodermic needle and were assayed for bacteriophage

leakage. In addition, one latex glove was torn approxi-

mately 1 cm at the index finger.

Preparation and assay of phage. Stock suspensions of

oX174 bacteriophage were prepared by growth in liquid

culture with Escherichia coli C (ATCC 13706) at 37°C (5).

The titer of 6X174 was determined by plaque formation

App. 80

using the tryptone top-agar layer method (5, 8). Phos-

phate-buffered saline (100 ml; pH 7.4) containing10® to

107 PFU of 9X174 was poured into each glove. The quan-

tity of liquid was enough to fill the glove to just about the

fingers. Each glove was held over an empty collection

container for 1 min and observed for leakage of liquid.

Each glove was then draped for 4 min over the edge of a

collection container such that the fingers were suspended

in the interior of the container and the empty remainder

of the glove fell over the exterior. Phosphate-buffered

saline (100 ml) was poured into the collection container,

and the fingers were immersed for 5 min more. Samples

(1ml) of the collection buffer were obtained after up-and-

down agitation and removal of the glove. In this study, a

visible leak was defined as a leak observed by the naked

eye. A viral leak was one in which virus was detected in

the collection container. The effective volume leaked from

each glove was calculated in microliters as the total

number of virus particles in the collection container

divided by the virus concentration inside the glove. The

chi-square and the Fisher exact tests were used to assess

differences in the proportions of gloves which leaked.

The Mann-Whitney U test was used to test for differences

in the volume of fluid leaked.

A total of 480 (240 vinyl and 240 latex) examination

gloves were tested, with 60 each in the four categories of

use. None of the latex gloves with needlestick holes had

visible leaks or were positive for viral leakage. However,

the torn latex glove was positive for both visible and viral

leaks (5.0 x 10 PFU). The punctured vinyl gloves had

both visible and viral leakage (two holes, 7.6 x 103 PFU;

five holes, 4.9 x 10° PFU). All test gloves with visible

App. 81

leaks also leaked virus (Fig.1). Virus leakage was found in

both types of gloves: 55 (22.9%) of 240 vinyl and 18 (7.5%)

of 240 latex gloves (x? = 20.94. P = 0.00005). In addition, in

34 (14.1%) of 240 vinyl gloves and 16 (7%) of 240 latex

gloves, visible leaks were not observed, but virus still

leaked through: 5 x 10? to 1 x 10° PFU per glove for vinyl

and 5 x 10? to 1.3 x 104 PFU for latex.

There were not statistically significant differences in

leakage rates for latex or vinyl gloves at use level 0, 1, or

2. However, as with visible leaks, there was a statistically

significant difference in viral leaks at use level 3. Of the

vinyl gloves, 63% (38 of 60) in use level 3 leaked virus

compared with 7% (4 of 60) of the latex gloves (Fisher

exact test, two tailed; P = 0.000001). There was a wide

range in the volume leaked at each of the four use levels

(Table 2). Vinyl gloves leaked more than latex gloves

(Mann-Whitney U test: P = 0.0001).

This study demonstrated that some vinyl and some

latex examination gloves permit viral leakage. At use

levels 0, 1, and 2, the proportions with viral leakage were

not significantly different between glove types. At use

level 3, more vinyl gloves than latex gloves leaked virus,

and the volume leaked was higher. The needlestick punc-

tures in the fingertips of gloves which were meant to

serve as positive controls resulted in visual and viral

leaks in the vinyl gloves but not in the latex gloves. This

result was unexpected and may have been caused by the

elastic resealing property of latex.

The high proportion of gloves that leaked some

amount of 0X174 indicates that the effective hole size is

greater than 27 nm, since that is the diameter of the virus

App. 82

particle. These findings are consistent with the work of

Kotilainen et al. who were able to detect leakage of pol-

iovirus (20 to 30 nm in diameter) through a glove barrier.

Further evidence suggests that microorganisms can pass

from the outside of a glove, through the glove, and onto

the hand.*®

These results, from the testing of a single brand of

vinyl gloves, suggest that holes can be formed during

procedures related to routine patient care. Under the

conditions of this study, latex gloves appeared to be less

susceptible to hole formulation than vinyl gloves.

Although these experiments should be expanded to

include other brands of both types of gloves, our results

suggest the need to change gloves after moderate periods

of use. In addition, since there may be viral leakage

during glove use, a conscientious handwashing technique

should be used after glove removal.

Table 1. Procedures for preparation of gloves prior to

test

Use Level Procedure

0 Remove from box

Don gloves and remove them

2 Levels 0 and 1 plus rub each gloved hand

with a washcloth in the following

sequence: palm each finger in a twisting

motion, thumb, and back of hand

ae)

Levels 0-2 plus (I) attach a capped needle

to a Luer-Lok syringe and then remove it

30 times; (ii) connect and disconnect

App. 83

Luer-Lok syringe to intravenous tubing

and manipulate a stopcock eight times;

(iii) wrap, tape, and unwrap a blunt

object two times to simulate bandaging

an amputation stump

4Use level in previous paper refers to manipulation level

(6).

Table 2. Volume leaked from vinyl and latex

This text is long and has been trimmed here. Open the source document for the complete record.